ZFIN ID: ZDB-CRISPR-200116-5
CRISPR Name: CRISPR2-myo9ab
Target: myo9ab (1)
Source:
Target Sequence:
5' - GGTGCAGACTTGGAGCCCAG - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: The first "G" was added to improve binding.
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM CRISPR2-myo9ab No data available
GENOMIC FEATURES CREATED WITH CRISPR2-myo9ab No data available
GENE EXPRESSION
Gene expression in Wild Types + CRISPR2-myo9ab No data available
PHENOTYPE
Phenotype resulting from CRISPR2-myo9ab
Phenotype of all Fish created by or utilizing CRISPR2-myo9ab
Phenotype Fish Conditions Figures
heart edematous, abnormal WT + CRISPR2-myo9ab standard conditions Fig. 1 with image from O'Connor et al., 2019
whole organism curved, abnormal WT + CRISPR2-myo9ab standard conditions Fig. 1 with image from O'Connor et al., 2019
thigmotaxis process quality, ameliorated WT + CRISPR1-myo9aa + CRISPR1-myo9ab + CRISPR2-myo9aa + CRISPR2-myo9ab chemical treatment by environment: fasudil hydrochloride Fig. 2 from O'Connor et al., 2019
whole organism movement behavioral quality, abnormal WT + CRISPR1-myo9aa + CRISPR1-myo9ab + CRISPR2-myo9aa + CRISPR2-myo9ab standard conditions Fig. 2 from O'Connor et al., 2019
heart edematous, abnormal WT + CRISPR1-myo9aa + CRISPR1-myo9ab + CRISPR2-myo9aa + CRISPR2-myo9ab standard conditions Fig. 1 with image from O'Connor et al., 2019
motor neuron axon decreased branchiness, abnormal WT + CRISPR1-myo9aa + CRISPR1-myo9ab + CRISPR2-myo9aa + CRISPR2-myo9ab standard conditions Fig. 5 with image from O'Connor et al., 2019
motor neuron axon branchiness, ameliorated WT + CRISPR1-myo9aa + CRISPR1-myo9ab + CRISPR2-myo9aa + CRISPR2-myo9ab chemical treatment by injection: peptide Fig. 5 with image from O'Connor et al., 2019
horizontal myoseptum neuromuscular junction of skeletal muscle fiber size, ameliorated WT + CRISPR1-myo9aa + CRISPR1-myo9ab + CRISPR2-myo9aa + CRISPR2-myo9ab chemical treatment by injection: peptide Fig. T1 from O'Connor et al., 2019
horizontal myoseptum synaptic vesicle ab-sv2 labeling absent, abnormal WT + CRISPR1-myo9aa + CRISPR1-myo9ab + CRISPR2-myo9aa + CRISPR2-myo9ab standard conditions Fig. 3 with image from O'Connor et al., 2019
whole organism behavioural activity, ameliorated WT + CRISPR1-myo9aa + CRISPR1-myo9ab + CRISPR2-myo9aa + CRISPR2-myo9ab chemical treatment by injection: peptide Fig. 2 from O'Connor et al., 2019
myotome size, ameliorated WT + CRISPR1-myo9aa + CRISPR1-myo9ab + CRISPR2-myo9aa + CRISPR2-myo9ab chemical treatment by environment: fasudil hydrochloride Fig. T1 from O'Connor et al., 2019
whole organism viability, ameliorated WT + CRISPR1-myo9aa + CRISPR1-myo9ab + CRISPR2-myo9aa + CRISPR2-myo9ab chemical treatment by environment: fasudil hydrochloride Fig. 2 from O'Connor et al., 2019
motor neuron axon decreased length, abnormal WT + CRISPR1-myo9aa + CRISPR1-myo9ab + CRISPR2-myo9aa + CRISPR2-myo9ab chemical treatment by environment: fasudil hydrochloride Fig. T1 from O'Connor et al., 2019
motor neuron axon decreased length, abnormal WT + CRISPR1-myo9aa + CRISPR1-myo9ab + CRISPR2-myo9aa + CRISPR2-myo9ab standard conditions Fig. 3 with imageFig. T1 from O'Connor et al., 2019
horizontal myoseptum synaptic vesicle ab-sv2 labeling amount, ameliorated WT + CRISPR1-myo9aa + CRISPR1-myo9ab + CRISPR2-myo9aa + CRISPR2-myo9ab chemical treatment by environment: fasudil hydrochloride Fig. 3 with image from O'Connor et al., 2019
thigmotaxis decreased linear velocity, abnormal WT + CRISPR1-myo9aa + CRISPR1-myo9ab + CRISPR2-myo9aa + CRISPR2-myo9ab standard conditions Fig. 2 from O'Connor et al., 2019
horizontal myoseptum neuromuscular junction of skeletal muscle fiber decreased amount, exacerbated WT + CRISPR1-myo9aa + CRISPR1-myo9ab + CRISPR2-myo9aa + CRISPR2-myo9ab chemical treatment by environment: fasudil hydrochloride Fig. T2 from O'Connor et al., 2019
myotome decreased size, abnormal WT + CRISPR1-myo9aa + CRISPR1-myo9ab + CRISPR2-myo9aa + CRISPR2-myo9ab chemical treatment by environment: fasudil hydrochloride Fig. T3 from O'Connor et al., 2019
motor neuron axon length, ameliorated WT + CRISPR1-myo9aa + CRISPR1-myo9ab + CRISPR2-myo9aa + CRISPR2-myo9ab chemical treatment by injection: peptide Fig. T1 from O'Connor et al., 2019
myotome size, ameliorated WT + CRISPR1-myo9aa + CRISPR1-myo9ab + CRISPR2-myo9aa + CRISPR2-myo9ab chemical treatment by injection: peptide Fig. T3 from O'Connor et al., 2019
thigmotaxis process quality, ameliorated WT + CRISPR1-myo9aa + CRISPR1-myo9ab + CRISPR2-myo9aa + CRISPR2-myo9ab chemical treatment by injection: peptide Fig. 2 from O'Connor et al., 2019
horizontal myoseptum neuromuscular junction of skeletal muscle fiber decreased amount, abnormal WT + CRISPR1-myo9aa + CRISPR1-myo9ab + CRISPR2-myo9aa + CRISPR2-myo9ab chemical treatment by environment: fasudil hydrochloride Fig. 5 with image from O'Connor et al., 2019
horizontal myoseptum synaptic vesicle ab-sv2 labeling amount, ameliorated WT + CRISPR1-myo9aa + CRISPR1-myo9ab + CRISPR2-myo9aa + CRISPR2-myo9ab chemical treatment by injection: peptide Fig. 3 with image from O'Connor et al., 2019
motor neuron axon decreased branchiness, abnormal WT + CRISPR1-myo9aa + CRISPR1-myo9ab + CRISPR2-myo9aa + CRISPR2-myo9ab chemical treatment by environment: fasudil hydrochloride Fig. 5 with image from O'Connor et al., 2019
myotome decreased size, exacerbated WT + CRISPR1-myo9aa + CRISPR1-myo9ab + CRISPR2-myo9aa + CRISPR2-myo9ab chemical treatment by injection: peptide Fig. T1 from O'Connor et al., 2019
horizontal myoseptum neuromuscular junction of skeletal muscle fiber amount, ameliorated WT + CRISPR1-myo9aa + CRISPR1-myo9ab + CRISPR2-myo9aa + CRISPR2-myo9ab chemical treatment by injection: peptide Fig. 5 with imageFig. T2 from O'Connor et al., 2019
horizontal myoseptum neuromuscular junction of skeletal muscle fiber decreased amount, abnormal WT + CRISPR1-myo9aa + CRISPR1-myo9ab + CRISPR2-myo9aa + CRISPR2-myo9ab standard conditions Fig. 4 with imageFig. 5 with imageFig. T2 from O'Connor et al., 2019
whole organism curved, abnormal WT + CRISPR1-myo9aa + CRISPR1-myo9ab + CRISPR2-myo9aa + CRISPR2-myo9ab standard conditions Fig. 1 with image from O'Connor et al., 2019
whole organism movement behavioral quality, ameliorated WT + CRISPR1-myo9aa + CRISPR1-myo9ab + CRISPR2-myo9aa + CRISPR2-myo9ab chemical treatment by injection: peptide Fig. 2 from O'Connor et al., 2019
horizontal myoseptum neuromuscular junction of skeletal muscle fiber size, ameliorated WT + CRISPR1-myo9aa + CRISPR1-myo9ab + CRISPR2-myo9aa + CRISPR2-myo9ab chemical treatment by environment: fasudil hydrochloride Fig. T1 from O'Connor et al., 2019
myotome decreased size, abnormal WT + CRISPR1-myo9aa + CRISPR1-myo9ab + CRISPR2-myo9aa + CRISPR2-myo9ab standard conditions Fig. T1Fig. T3 from O'Connor et al., 2019
horizontal myoseptum neuromuscular junction of skeletal muscle fiber decreased size, abnormal WT + CRISPR1-myo9aa + CRISPR1-myo9ab + CRISPR2-myo9aa + CRISPR2-myo9ab standard conditions Fig. T1 from O'Connor et al., 2019
myotome synapse ab-sv2 labeling decreased amount, abnormal WT + CRISPR1-myo9aa + CRISPR1-myo9ab + CRISPR2-myo9aa + CRISPR2-myo9ab standard conditions Fig. T2 from O'Connor et al., 2019
whole organism decreased behavioural activity, abnormal WT + CRISPR1-myo9aa + CRISPR1-myo9ab + CRISPR2-myo9aa + CRISPR2-myo9ab standard conditions Fig. 2 from O'Connor et al., 2019
Genome Resources:
CITATIONS (1)