Morpholino
MO3-pkd2
- ID
- ZDB-MRPHLNO-060630-4
- Name
- MO3-pkd2
- Previous Names
- Target
- Sequence
-
5' - AGGACGAACGCGACTGGAGCTCATC - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
- None
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO3-pkd2
No data available
Phenotype
Phenotype resulting from MO3-pkd2
1 - 5 of 69 Show all
Phenotype of all Fish created by or utilizing MO3-pkd2
1 - 5 of 156 Show all
Citations
- Djenoune, L., Mahamdeh, M., Truong, T.V., Nguyen, C.T., Fraser, S.E., Brueckner, M., Howard, J., Yuan, S. (2023) Cilia function as calcium-mediated mechanosensors that instruct left-right asymmetry. Science (New York, N.Y.). 379:717871-78
- Padhy, B., Xie, J., Wang, R., Lin, F., Huang, C.L. (2022) Channel Function of Polycystin-2 in the Endoplasmic Reticulum Protects against Autosomal Dominant Polycystic Kidney Disease. Journal of the American Society of Nephrology : JASN. 33(8):1501-1516
- Vignes, H., Vagena-Pantoula, C., Prakash, M., Fukui, H., Norden, C., Mochizuki, N., Jug, F., Vermot, J. (2022) Extracellular mechanical forces drive endocardial cell volume decrease during zebrafish cardiac valve morphogenesis. Developmental Cell. 57(5):598-609.e5
- Chen, S., Huang, L., Zhou, S., Zhang, Q., Ruan, M., Fu, L., Yang, B., Xu, D., Mei, C., Mao, Z. (2021) NS398 as a potential drug for autosomal-dominant polycystic kidney disease: Analysis using bioinformatics, and zebrafish and mouse models. Journal of Cellular and Molecular Medicine. 25(20):9597-9608
- Geng, F., Ma, J., Li, X., Hu, Z., Zhang, R. (2021) Hemodynamic Forces Regulate Cardiac Regeneration-Responsive Enhancer Activity during Ventricle Regeneration. International Journal of Molecular Sciences. 22(8):
- Jacinto, R., Sampaio, P., Roxo-Rosa, M., Pestana, S., Lopes, S.S. (2021) Pkd2 Affects Cilia Length and Impacts LR Flow Dynamics and Dand5. Frontiers in cell and developmental biology. 9:624531
- Maerker, M., Getwan, M., Dowdle, M.E., McSheene, J.C., Gonzalez, V., Pelliccia, J.L., Hamilton, D.S., Yartseva, V., Vejnar, C., Tingler, M., Minegishi, K., Vick, P., Giraldez, A.J., Hamada, H., Burdine, R.D., Sheets, M.D., Blum, M., Schweickert, A. (2021) Bicc1 and Dicer regulate left-right patterning through post-transcriptional control of the Nodal inhibitor Dand5. Nature communications. 12:5482
- Metzner, A., Griffiths, J.D., Streets, A.J., Markham, E., Philippou, T., Van Eeden, F.J.M., Ong, A.C.M. (2020) A high throughput zebrafish chemical screen reveals ALK5 and non-canonical androgen signalling as modulators of the pkd2-/- phenotype. Scientific Reports. 10:72
- Verschuren, E.H.J., Rigalli, J.P., Castenmiller, C., Rohrbach, M.U., Bindels, R.J.M., Peters, D.J.M., Arjona, F.J., Hoenderop, J.G.J. (2020) Pannexin-1 mediates fluid shear stress-sensitive purinergic signaling and cyst growth in polycystic kidney disease. FASEB journal : official publication of the Federation of American Societies for Experimental Biology. 34(5):6382-6398
- Arhatte, M., Gunaratne, G.S., El Boustany, C., Kuo, I.Y., Moro, C., Duprat, F., Plaisant, M., Duval, H., Li, D., Picard, N., Couvreux, A., Duranton, C., Rubera, I., Pagnotta, S., Lacas-Gervais, S., Ehrlich, B.E., Marchant, J.S., Savage, A.M., van Eeden, F.J.M., Wilkinson, R.N., Demolombe, S., Honoré, E., Patel, A. (2019) TMEM33 regulates intracellular calcium homeostasis in renal tubular epithelial cells. Nature communications. 10:2024
1 - 10 of 43
Show