Morpholino
MO1-myf5
- ID
- ZDB-MRPHLNO-060322-3
- Name
- MO1-myf5
- Previous Names
-
- MO2-myf5
- Target
- Sequence
-
5' - TACGTCCATGATTGGTTTGGTGTTG - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
- None
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-myf5
No data available
Phenotype
Phenotype resulting from MO1-myf5
1 - 5 of 22 Show all
Phenotype of all Fish created by or utilizing MO1-myf5
1 - 5 of 32 Show all
Citations
- Chen, J.W., Galloway, J.L. (2014) The development of zebrafish tendon and ligament progenitors. Development (Cambridge, England). 141:2035-45
- Lin, C.Y., Lee, H.C., Chen, H.C., Hsieh, C.C., and Tsai, H.J. (2013) Normal Function of Myf5 During Gastrulation Is Required for Pharyngeal Arch Cartilage Development in Zebrafish Embryos. Zebrafish. 10(4):486-99
- Wang, X., Ono, Y., Tan, S.C., Chai, R.J., Parkin, C., and Ingham, P.W. (2011) Prdm1a and miR-499 act sequentially to restrict Sox6 activity to the fast-twitch muscle lineage in the zebrafish embryo. Development (Cambridge, England). 138(20):4399-404
- Schnapp, E., Pistocchi, A.S., Karampetsou, E., Foglia, E., Lamia, C.L., Cotelli, F., and Cossu, G. (2009) Induced early expression of mrf4 but not myog rescues myogenesis in the myod/myf5 double-morphant zebrafish embryo. Journal of Cell Science. 122(Pt 4):481-488
- Liew, H.P., Choksi, S.P., Wong, K.N., and Roy, S. (2008) Specification of vertebrate slow-twitch muscle fiber fate by the transcriptional regulator Blimp1. Developmental Biology. 324(2):226-235
- Lee, H.C., Huang, H.Y., Lin, C.Y., Chen, Y.H., and Tsai, H.J. (2006) Foxd3 mediates zebrafish myf5 expression during early somitogenesis. Developmental Biology. 290(2):359-372
- Lin, C.Y., Yung, R.F., Lee, H.C., Chen, W.T., Chen, Y.H., and Tsai, H.J. (2006) Myogenic regulatory factors Myf5 and Myod function distinctly during craniofacial myogenesis of zebrafish. Developmental Biology. 299(2):594-608
- Chen, Y.-H. and Tsai, H.-J. (2002) Treatment with Myf5-morpholino results in somite patterning and brain formation defects in zebrafish. Differentiation; research in biological diversity. 70(8):447-456
1 - 8 of 8
Show