Morpholino

MO3-sdc4

ID
ZDB-MRPHLNO-120425-8
Name
MO3-sdc4
Previous Names
  • MOsdc4 (1)
Target
Sequence
5' - TGAGGTAAACTTTCAACATCTTCTC - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Translation-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO3-sdc4
Phenotype
Phenotype resulting from MO3-sdc4
Phenotype Fish Figures
CaP motoneuron morphology, abnormal ml2Tg + MO3-sdc4 Fig. 6 with image from Luo et al., 2016
CaP motoneuron axon decreased length, abnormal ml2Tg + MO3-sdc4 Fig. 6 with image from Luo et al., 2016
CaP motoneuron axon increased branchiness, abnormal ml2Tg + MO3-sdc4 Fig. 6 with image from Luo et al., 2016
epiboly involved in gastrulation with mouth forming second disrupted, abnormal AB + MO3-sdc4 Fig. 5 from Lambaerts et al., 2012
forebrain ventricular zone nes expression increased amount, abnormal AB + MO3-sdc4 Fig. 2 with image from Luo et al., 2016
forebrain ventricular zone gfap expression increased amount, abnormal AB + MO3-sdc4 Fig. 3 with image from Luo et al., 2016
hindbrain ventricular zone nes expression increased amount, abnormal AB + MO3-sdc4 Fig. 2 with image from Luo et al., 2016
midbrain elavl3 expression increased amount, abnormal AB + MO3-sdc4 Fig. 4 with image from Luo et al., 2016
midbrain ventricular zone gfap expression increased amount, abnormal AB + MO3-sdc4 Fig. 3 with image from Luo et al., 2016
neuronal stem cell nes expression increased amount, abnormal AB + MO3-sdc4 Fig. 2 with image from Luo et al., 2016
spinal cord elavl3 expression increased amount, abnormal AB + MO3-sdc4 Fig. 4 with image from Luo et al., 2016
spinal cord gfap expression increased amount, abnormal AB + MO3-sdc4 Fig. 3 with image from Luo et al., 2016
spinal cord olig2 expression increased amount, abnormal AB + MO3-sdc4 Fig. 3 with imageFig. 5 with image from Luo et al., 2016
spinal cord dorsal region slc1a3a expression increased amount, abnormal AB + MO3-sdc4 Fig. 3 with image from Luo et al., 2016
spinal cord ventral region isl1a expression increased amount, abnormal AB + MO3-sdc4 Fig. 4 with image from Luo et al., 2016
spinal cord ventral region isl2a expression increased amount, abnormal AB + MO3-sdc4 Fig. 4 with image from Luo et al., 2016
whole organism isl2a expression increased amount, abnormal AB + MO3-sdc4 Fig. 4 with image from Luo et al., 2016
whole organism slc1a3a expression increased amount, abnormal AB + MO3-sdc4 Fig. 3 with image from Luo et al., 2016
whole organism olig2 expression increased amount, abnormal AB + MO3-sdc4 Fig. 3 with image from Luo et al., 2016
whole organism nes expression increased amount, abnormal AB + MO3-sdc4 Fig. 2 with image from Luo et al., 2016
whole organism gfap expression increased amount, abnormal AB + MO3-sdc4 Fig. 3 with image from Luo et al., 2016
whole organism elavl3 expression increased amount, abnormal AB + MO3-sdc4 Fig. 4 with image from Luo et al., 2016
whole organism isl1a expression increased amount, abnormal AB + MO3-sdc4 Fig. 4 with image from Luo et al., 2016
Phenotype of all Fish created by or utilizing MO3-sdc4
Phenotype Fish Conditions Figures
hindbrain ventricular zone nes expression increased amount, abnormal AB + MO3-sdc4 standard conditions Fig. 2 with image from Luo et al., 2016
spinal cord ventral region isl2a expression increased amount, abnormal AB + MO3-sdc4 standard conditions Fig. 4 with image from Luo et al., 2016
midbrain elavl3 expression increased amount, abnormal AB + MO3-sdc4 standard conditions Fig. 4 with image from Luo et al., 2016
spinal cord gfap expression increased amount, abnormal AB + MO3-sdc4 standard conditions Fig. 3 with image from Luo et al., 2016
whole organism isl2a expression increased amount, abnormal AB + MO3-sdc4 standard conditions Fig. 4 with image from Luo et al., 2016
spinal cord elavl3 expression increased amount, abnormal AB + MO3-sdc4 standard conditions Fig. 4 with image from Luo et al., 2016
whole organism nes expression increased amount, abnormal AB + MO3-sdc4 standard conditions Fig. 2 with image from Luo et al., 2016
whole organism olig2 expression increased amount, abnormal AB + MO3-sdc4 standard conditions Fig. 3 with image from Luo et al., 2016
forebrain ventricular zone gfap expression increased amount, abnormal AB + MO3-sdc4 standard conditions Fig. 3 with image from Luo et al., 2016
spinal cord dorsal region slc1a3a expression increased amount, abnormal AB + MO3-sdc4 standard conditions Fig. 3 with image from Luo et al., 2016
midbrain ventricular zone gfap expression increased amount, abnormal AB + MO3-sdc4 standard conditions Fig. 3 with image from Luo et al., 2016
epiboly involved in gastrulation with mouth forming second disrupted, abnormal AB + MO3-sdc4 standard conditions Fig. 5 from Lambaerts et al., 2012
whole organism isl1a expression increased amount, abnormal AB + MO3-sdc4 standard conditions Fig. 4 with image from Luo et al., 2016
spinal cord olig2 expression increased amount, abnormal AB + MO3-sdc4 standard conditions Fig. 3 with imageFig. 5 with image from Luo et al., 2016
whole organism gfap expression increased amount, abnormal AB + MO3-sdc4 standard conditions Fig. 3 with image from Luo et al., 2016
whole organism elavl3 expression increased amount, abnormal AB + MO3-sdc4 standard conditions Fig. 4 with image from Luo et al., 2016
whole organism slc1a3a expression increased amount, abnormal AB + MO3-sdc4 standard conditions Fig. 3 with image from Luo et al., 2016
forebrain ventricular zone nes expression increased amount, abnormal AB + MO3-sdc4 standard conditions Fig. 2 with image from Luo et al., 2016
spinal cord ventral region isl1a expression increased amount, abnormal AB + MO3-sdc4 standard conditions Fig. 4 with image from Luo et al., 2016
neuronal stem cell nes expression increased amount, abnormal AB + MO3-sdc4 standard conditions Fig. 2 with image from Luo et al., 2016
CaP motoneuron morphology, abnormal ml2Tg + MO3-sdc4 standard conditions Fig. 6 with image from Luo et al., 2016
CaP motoneuron axon increased branchiness, abnormal ml2Tg + MO3-sdc4 standard conditions Fig. 6 with image from Luo et al., 2016
CaP motoneuron axon decreased length, abnormal ml2Tg + MO3-sdc4 standard conditions Fig. 6 with image from Luo et al., 2016
Citations