Morpholino

MO1-yap1

ID
ZDB-MRPHLNO-090609-10
Name
MO1-yap1
Previous Names
None
Target
Sequence
5' - AGCAACATTAACAACTCACTTTAGG - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
2e2i
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-yap1
No data available
Phenotype
Phenotype resulting from MO1-yap1
Phenotype Fish Figures
cardiac muscle progenitor cell migration to the midline involved in heart field formation decreased occurrence, abnormal AB + MO1-yap1 Fig. 1 with image,  Fig. 2 with image,  Fig. 3 with image from Fukui et al., 2014
determination of heart left/right asymmetry disrupted, abnormal AB/TU + MO1-yap1 Figure 1 with image from Fillatre et al., 2019
endoderm cellular quality, abnormal ha01Tg + MO1-yap1 Fig. 4 with image from Fukui et al., 2014
endoderm anterior region apoptotic, abnormal ha01Tg + MO1-yap1 Fig. 3 with image from Fukui et al., 2014
endoderm antero-medial region decreased object quality, abnormal ha01Tg; ncv11Tg + MO1-yap1 Fig. 2 with image from Fukui et al., 2014
endoderm apoptotic process increased occurrence, abnormal ha01Tg + MO1-yap1 Fig. 3 with image from Fukui et al., 2014
eye decreased size, abnormal mw50Tg + MO1-yap1 + MO4-tp53 Fig. 4 from Miesfeld et al., 2014
heart d2EGFP expression decreased amount, abnormal mw50Tg + MO1-yap1 + MO4-tp53 Fig. 4 from Miesfeld et al., 2014
heart malformed, abnormal ncv10Tg + MO1-yap1 Fig. 1 with image from Fukui et al., 2014
heart split bilaterally, abnormal ncv10Tg + MO1-yap1 Fig. 1 with image from Fukui et al., 2014
heart jogging process quality, abnormal AB/TU + MO1-yap1 Figure 1 with image from Fillatre et al., 2019
heart morphogenesis decreased process quality, abnormal ha01Tg + MO1-yap1 Fig. 1 with image,  Fig. 2 with image,  Fig. 3 with image from Fukui et al., 2014
heart tube mislocalised, abnormal AB/TU + MO1-yap1 Figure 1 with image from Fillatre et al., 2019
heart tube split bilaterally, abnormal ha01Tg; ncv11Tg + MO1-yap1 Fig. 1 with image,  Fig. 2 with image,  Fig. 3 with image from Fukui et al., 2014
myocardial precursor mislocalised laterally, abnormal ha01Tg; ncv11Tg + MO1-yap1 Fig. 1 with image,  Fig. 2 with image from Fukui et al., 2014
pancreas development disrupted, abnormal WT + MO1-yap1 Fig. 7 from Cebola et al., 2015
pancreatic bud decreased size, abnormal WT + MO1-yap1 Fig. 7 from Cebola et al., 2015
pancreatic bud lacks parts or has fewer parts of type cell, abnormal WT + MO1-yap1 Fig. 7 from Cebola et al., 2015
pharyngeal endoderm mislocalised laterally, abnormal AB + MO1-yap1 Fig. 2 with image from Fukui et al., 2014
posterior lateral line primordium d2EGFP expression decreased amount, abnormal fu16Tg/fu16Tg; mw50Tg/mw50Tg + MO1-yap1 Fig. 6 with image from Lardennois et al., 2026
posterior lateral line primordium has fewer parts of type posterior lateral line primordium cell, abnormal zf106Tg + MO1-yap1 Fig. 5 with image,  Fig. 6 with image from Agarwala et al., 2015
posterior lateral line primordium ab1-ctnnb labeling spatial pattern, abnormal fu16Tg/fu16Tg; mw50Tg/mw50Tg + MO1-yap1 Fig. 6 with image from Lardennois et al., 2026
posterior pancreatic bud decreased size, abnormal WT + MO1-yap1 Fig. S7 from Cebola et al., 2015
pronephros cystic, abnormal WT + MO1-yap1 Fig. 3 with image from Skouloudaki et al., 2009
retinal pigmented epithelium d2EGFP expression decreased amount, abnormal mw50Tg + MO1-yap1 + MO4-tp53 Fig. 4 from Miesfeld et al., 2014
trunk musculature striated muscle cell d2EGFP expression decreased amount, abnormal mw50Tg + MO1-yap1 + MO4-tp53 Fig. 4 from Miesfeld et al., 2014
whole organism has extra parts of type posterior pancreatic bud, abnormal WT + MO1-yap1 Fig. S7 from Cebola et al., 2015
Phenotype of all Fish created by or utilizing MO1-yap1
Phenotype Fish Conditions Figures
myocardial precursor mislocalised laterally, abnormal AB + MO1-yap1 standard conditions Fig. 1 with image from Fukui et al., 2014
endoderm cellular quality, abnormal AB + MO1-yap1 standard conditions Fig. 4 with image from Fukui et al., 2014
cardiac muscle progenitor cell migration to the midline involved in heart field formation decreased occurrence, abnormal AB + MO1-yap1 standard conditions Fig. 1 with image from Fukui et al., 2014
pharyngeal endoderm mislocalised laterally, abnormal AB + MO1-yap1 standard conditions Fig. 2 with image from Fukui et al., 2014
heart tube split bilaterally, abnormal AB + MO1-yap1 standard conditions Fig. 1 with image from Fukui et al., 2014
heart tube mislocalised, abnormal AB/TU + MO1-yap1 standard conditions Figure 1 with image from Fillatre et al., 2019
determination of heart left/right asymmetry disrupted, abnormal AB/TU + MO1-yap1 standard conditions Figure 1 with image from Fillatre et al., 2019
heart jogging process quality, abnormal AB/TU + MO1-yap1 standard conditions Figure 1 with image from Fillatre et al., 2019
pancreatic bud lacks parts or has fewer parts of type cell, abnormal WT + MO1-yap1 standard conditions Fig. 7 from Cebola et al., 2015
posterior pancreatic bud decreased size, abnormal WT + MO1-yap1 control Fig. S7 from Cebola et al., 2015
pancreatic bud decreased size, abnormal WT + MO1-yap1 standard conditions Fig. 7 from Cebola et al., 2015
pancreas development disrupted, abnormal WT + MO1-yap1 standard conditions Fig. 7 from Cebola et al., 2015
whole organism has extra parts of type posterior pancreatic bud, abnormal WT + MO1-yap1 control Fig. S7 from Cebola et al., 2015
pronephros cystic, abnormal WT + MO1-yap1 standard conditions Fig. 3 with image from Skouloudaki et al., 2009
cardiac muscle progenitor cell migration to the midline involved in heart field formation decreased occurrence, abnormal ha01Tg + MO1-yap1 standard conditions Fig. 3 with image from Fukui et al., 2014
heart tube split bilaterally, abnormal ha01Tg + MO1-yap1 standard conditions Fig. 3 with image from Fukui et al., 2014
endoderm cellular quality, abnormal ha01Tg + MO1-yap1 standard conditions Fig. 4 with image from Fukui et al., 2014
endoderm anterior region apoptotic, abnormal ha01Tg + MO1-yap1 standard conditions Fig. 3 with image from Fukui et al., 2014
endoderm apoptotic process increased occurrence, abnormal ha01Tg + MO1-yap1 standard conditions Fig. 3 with image from Fukui et al., 2014
heart morphogenesis decreased process quality, abnormal ha01Tg + MO1-yap1 standard conditions Fig. 3 with image from Fukui et al., 2014
trunk musculature striated muscle cell d2EGFP expression decreased amount, abnormal mw50Tg + MO1-yap1 + MO4-tp53 standard conditions Fig. 4 from Miesfeld et al., 2014
retinal pigmented epithelium d2EGFP expression decreased amount, abnormal mw50Tg + MO1-yap1 + MO4-tp53 standard conditions Fig. 4 from Miesfeld et al., 2014
eye decreased size, abnormal mw50Tg + MO1-yap1 + MO4-tp53 standard conditions Fig. 4 from Miesfeld et al., 2014
heart d2EGFP expression decreased amount, abnormal mw50Tg + MO1-yap1 + MO4-tp53 standard conditions Fig. 4 from Miesfeld et al., 2014
heart split bilaterally, abnormal ncv10Tg + MO1-yap1 standard conditions Fig. 1 with image from Fukui et al., 2014
heart morphogenesis decreased process quality, abnormal ncv10Tg + MO1-yap1 standard conditions Fig. 1 with image from Fukui et al., 2014
heart malformed, abnormal ncv10Tg + MO1-yap1 standard conditions Fig. 1 with image from Fukui et al., 2014
posterior lateral line primordium has fewer parts of type posterior lateral line primordium cell, abnormal zf106Tg + MO1-yap1 standard conditions Fig. 5 with image,  Fig. 6 with image from Agarwala et al., 2015
posterior lateral line primordium d2EGFP expression decreased amount, abnormal fu16Tg/fu16Tg; mw50Tg/mw50Tg + MO1-yap1 standard conditions Fig. 6 with image from Lardennois et al., 2026
posterior lateral line primordium ab1-ctnnb labeling spatial pattern, abnormal fu16Tg/fu16Tg; mw50Tg/mw50Tg + MO1-yap1 standard conditions Fig. 6 with image from Lardennois et al., 2026
endoderm antero-medial region decreased object quality, abnormal ha01Tg; ncv11Tg + MO1-yap1 standard conditions Fig. 2 with image from Fukui et al., 2014
heart morphogenesis decreased process quality, abnormal ha01Tg; ncv11Tg + MO1-yap1 standard conditions Fig. 2 with image from Fukui et al., 2014
heart tube split bilaterally, abnormal ha01Tg; ncv11Tg + MO1-yap1 standard conditions Fig. 2 with image from Fukui et al., 2014
cardiac muscle progenitor cell migration to the midline involved in heart field formation decreased occurrence, abnormal ha01Tg; ncv11Tg + MO1-yap1 standard conditions Fig. 2 with image from Fukui et al., 2014
myocardial precursor mislocalised laterally, abnormal ha01Tg; ncv11Tg + MO1-yap1 standard conditions Fig. 2 with image from Fukui et al., 2014
Kupffer's vesicle motile cilium decreased length, abnormal AB/TU + MO1-yap1 + MO4-wwtr1 standard conditions Figure 3 with image from Fillatre et al., 2019
heart tube mislocalised, abnormal AB/TU + MO1-yap1 + MO4-wwtr1 standard conditions Figure 1 with image from Fillatre et al., 2019
determination of heart left/right asymmetry disrupted, exacerbated AB/TU + MO1-yap1 + MO4-wwtr1 standard conditions Figure 1 with image from Fillatre et al., 2019
forerunner cell group decreased amount, abnormal AB/TU + MO1-yap1 + MO4-wwtr1 standard conditions Figure 2 with image from Fillatre et al., 2019
heart jogging process quality, abnormal AB/TU + MO1-yap1 + MO4-wwtr1 standard conditions Figure 1 with image from Fillatre et al., 2019
Kupffer's vesicle decreased size, abnormal AB/TU + MO1-yap1 + MO4-wwtr1 standard conditions Figure 2 with image from Fillatre et al., 2019
forerunner cell group apoptotic process increased occurrence, abnormal AB/TU + MO1-yap1 + MO4-wwtr1 standard conditions Figure 2 with image from Fillatre et al., 2019
posterior lateral line primordium has number of posterior lateral line primordium cell, ameliorated zf106Tg + MO1-amotl2a + MO1-yap1 standard conditions Fig. 6 with image from Agarwala et al., 2015
posterior lateral line primordium cell population proliferation occurrence, ameliorated zf106Tg + MO1-amotl2a + MO1-yap1 standard conditions Fig. 6 with image from Agarwala et al., 2015
heart split bilaterally, abnormal ha01Tg; ncv11Tg + MO1-yap1 + MO3-ccn2a standard conditions Fig. 4 with image from Fukui et al., 2014
myocardial precursor mislocalised laterally, abnormal ha01Tg; ncv11Tg + MO1-yap1 + MO3-ccn2a standard conditions Fig. 4 with image from Fukui et al., 2014
heart morphogenesis decreased process quality, abnormal ha01Tg; ncv11Tg + MO1-yap1 + MO3-ccn2a standard conditions Fig. 4 with image from Fukui et al., 2014
cardiac muscle progenitor cell migration to the midline involved in heart field formation decreased occurrence, abnormal ha01Tg; ncv11Tg + MO1-yap1 + MO3-ccn2a standard conditions Fig. 4 with image from Fukui et al., 2014
endoderm antero-medial region decreased object quality, abnormal ha01Tg; ncv11Tg + MO1-yap1 + MO3-ccn2a standard conditions Fig. 4 with image from Fukui et al., 2014
rhombomere cell population proliferation decreased occurrence, abnormal wwtr1fu55/+; mw50Tg + MO1-yap1 + MO4-tp53 control Fig. 5 from Voltes et al., 2019
endoderm antero-medial region decreased object quality, abnormal ha01Tg; ncv11Tg + MO1-gna13a + MO1-gna13b + MO1-yap1 + MO3-ccn2a standard conditions Fig. 2 with image from Fukui et al., 2014
heart morphogenesis decreased process quality, abnormal ha01Tg; ncv11Tg + MO1-gna13a + MO1-gna13b + MO1-yap1 + MO3-ccn2a standard conditions Fig. 2 with image from Fukui et al., 2014
heart tube split bilaterally, abnormal ha01Tg; ncv11Tg + MO1-gna13a + MO1-gna13b + MO1-yap1 + MO3-ccn2a standard conditions Fig. 2 with image from Fukui et al., 2014
myocardial precursor mislocalised laterally, abnormal ha01Tg; ncv11Tg + MO1-gna13a + MO1-gna13b + MO1-yap1 + MO3-ccn2a standard conditions Fig. 2 with image from Fukui et al., 2014
cardiac muscle progenitor cell migration to the midline involved in heart field formation decreased occurrence, abnormal ha01Tg; ncv11Tg + MO1-gna13a + MO1-gna13b + MO1-yap1 + MO3-ccn2a standard conditions Fig. 2 with image from Fukui et al., 2014
Citations