Morpholino

MO1-snai1b

ID
ZDB-MRPHLNO-080310-1
Name
MO1-snai1b
Previous Names
None
Target
Sequence
5' - TGCAAATATCCCCTCGAAACTTCAG - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
translation-blocker corresponding to bases -28 to -4 relative to start codon
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-snai1b
No data available
Phenotype
Phenotype resulting from MO1-snai1b
Phenotype Fish Figures
atrium position, abnormal twu34Tg + MO1-snai1b Fig. 1 with image from Qiao et al., 2014
cardiac muscle progenitor cell migration to the midline involved in heart field formation delayed, abnormal AB + MO1-snai1b Fig. 2 with image from Qiao et al., 2014
cardiac muscle progenitor cell migration to the midline involved in heart field formation process quality, abnormal AB + MO1-snai1b Fig. 2 with image from Qiao et al., 2014
cardiac ventricle decreased size, abnormal twu34Tg + MO1-snai1b Fig. 1 with image from Qiao et al., 2014
cardioblast cell midline fusion delayed, abnormal AB + MO1-snai1b Fig. 2 with image from Qiao et al., 2014
cell migration involved in gastrulation decreased rate, abnormal WT + MO1-snai1b Fig. 5 with image from Blanco et al., 2007
cell migration to the midline involved in heart development delayed, abnormal AB + MO1-snai1b Fig. 2 with image from Qiao et al., 2014
cell migration to the midline involved in heart development process quality, abnormal AB + MO1-snai1b Fig. 2 with image from Qiao et al., 2014
cell-cell adhesion increased occurrence, abnormal WT + MO1-snai1b Fig. 5 with image from Blanco et al., 2007
convergent extension involved in axis elongation disrupted, abnormal WT + MO1-snai1b Fig. 1 with image from Blanco et al., 2007
heart looping process quality, abnormal AB + MO1-snai1b Fig. 1 with image,  Fig. 2 with image from Qiao et al., 2014
pericardium edematous, abnormal AB + MO1-snai1b Fig. 1 with image,  Fig. 2 with image from Qiao et al., 2014
polster increased length, abnormal WT + MO1-snai1b Fig. 3 with image from Blanco et al., 2007
polster morphology, abnormal WT + MO1-snai1b Fig. 3 with image from Blanco et al., 2007
post-vent region decreased length, abnormal WT + MO1-snai1b Fig. 1 with image from Blanco et al., 2007
posterior lateral line has fewer parts of type posterior lateral line neuromast, abnormal zf106Tg + MO1-snai1b Fig. 3 with image from Neelathi et al., 2018
posterior lateral line primordium anterior region etv4 expression decreased amount, abnormal zf106Tg + MO1-snai1b Fig. 5 with image from Neelathi et al., 2018
posterior lateral line primordium anterior region ackr3b expression decreased amount, abnormal zf106Tg + MO1-snai1b Fig. 5 with image from Neelathi et al., 2018
posterior lateral line primordium anterior region ackr3b expression decreased distribution, abnormal zf106Tg + MO1-snai1b Fig. 5 with image from Neelathi et al., 2018
posterior lateral line primordium anterior region lef1 expression increased amount, abnormal zf106Tg + MO1-snai1b Fig. 5 with image from Neelathi et al., 2018
posterior lateral line primordium anterior region cxcr4b expression increased amount, abnormal zf106Tg + MO1-snai1b Fig. 5 with image from Neelathi et al., 2018
posterior lateral line primordium anterior region ackr3b expression increased amount, abnormal zf106Tg + MO1-snai1b Fig. 5 with image from Neelathi et al., 2018
posterior lateral line primordium anterior region lef1 expression mislocalised, abnormal zf106Tg + MO1-snai1b Fig. 5 with image from Neelathi et al., 2018
posterior lateral line primordium anterior region cxcr4b expression mislocalised, abnormal zf106Tg + MO1-snai1b Fig. 5 with image from Neelathi et al., 2018
posterior lateral line primordium anterior region ackr3b expression mislocalised, abnormal zf106Tg + MO1-snai1b Fig. 5 with image from Neelathi et al., 2018
posterior lateral line primordium central region etv4 expression decreased amount, abnormal zf106Tg + MO1-snai1b Fig. 5 with image from Neelathi et al., 2018
posterior lateral line primordium central region lef1 expression increased amount, abnormal zf106Tg + MO1-snai1b Fig. 5 with image from Neelathi et al., 2018
posterior lateral line primordium central region cxcr4b expression increased amount, abnormal zf106Tg + MO1-snai1b Fig. 5 with image from Neelathi et al., 2018
posterior lateral line primordium central region cxcr4b expression mislocalised, abnormal zf106Tg + MO1-snai1b Fig. 5 with image from Neelathi et al., 2018
posterior lateral line primordium central region lef1 expression mislocalised, abnormal zf106Tg + MO1-snai1b Fig. 5 with image from Neelathi et al., 2018
posterior lateral line primordium posterior lateral line neuromast deposition delayed, abnormal zf106Tg + MO1-snai1b Fig. 3 with image from Neelathi et al., 2018
posterior lateral line primordium posterior lateral line neuromast primordium migration decreased rate, abnormal zf106Tg + MO1-snai1b Fig. 3 with image,  Fig. 4 with image from Neelathi et al., 2018
posterior lateral line primordium posterior region cdh2 expression decreased amount, abnormal zf106Tg + MO1-snai1b Fig. 4 with image from Neelathi et al., 2018
posterior lateral line primordium posterior region etv4 expression decreased amount, abnormal zf106Tg + MO1-snai1b Fig. 5 with image from Neelathi et al., 2018
posterior lateral line primordium posterior region epcam expression increased amount, abnormal zf106Tg + MO1-snai1b Fig. 4 with image from Neelathi et al., 2018
posterior lateral line primordium posterior region lef1 expression increased amount, abnormal zf106Tg + MO1-snai1b Fig. 5 with image from Neelathi et al., 2018
posterior lateral line primordium posterior region lef1 expression increased distribution, abnormal zf106Tg + MO1-snai1b Fig. 5 with image from Neelathi et al., 2018
posterior lateral line primordium posterior region lef1 expression mislocalised, abnormal zf106Tg + MO1-snai1b Fig. 5 with image from Neelathi et al., 2018
prechordal plate elongated, abnormal WT + MO1-snai1b Fig. 7 with image from Blanco et al., 2007
prechordal plate increased size, abnormal WT + MO1-snai1b Fig. S3 with image from Blanco et al., 2007
prechordal plate shape, abnormal WT + MO1-snai1b Fig. S3 with image from Blanco et al., 2007
somite shape, abnormal WT + MO1-snai1b Fig. 2 with image from Blanco et al., 2007
somite border morphology, abnormal AB + MO1-snai1b Fig. S7 with image from Qiao et al., 2014
trunk decreased length, abnormal WT + MO1-snai1b Fig. 1 with image from Blanco et al., 2007
whole organism anterior-posterior axis decreased length, abnormal WT + MO1-snai1b Fig. 1 with image from Blanco et al., 2007
Phenotype of all Fish created by or utilizing MO1-snai1b
Phenotype Fish Conditions Figures
somite border morphology, abnormal AB + MO1-snai1b standard conditions Fig. S7 with image from Qiao et al., 2014
heart looping process quality, abnormal AB + MO1-snai1b standard conditions Fig. 1 with image,  Fig. 2 with image from Qiao et al., 2014
cardioblast cell midline fusion delayed, abnormal AB + MO1-snai1b standard conditions Fig. 2 with image from Qiao et al., 2014
cardiac muscle progenitor cell migration to the midline involved in heart field formation delayed, abnormal AB + MO1-snai1b standard conditions Fig. 2 with image from Qiao et al., 2014
cell migration to the midline involved in heart development process quality, abnormal AB + MO1-snai1b standard conditions Fig. 2 with image from Qiao et al., 2014
cardiac muscle progenitor cell migration to the midline involved in heart field formation process quality, abnormal AB + MO1-snai1b standard conditions Fig. 2 with image from Qiao et al., 2014
pericardium edematous, abnormal AB + MO1-snai1b standard conditions Fig. 1 with image,  Fig. 2 with image from Qiao et al., 2014
cell migration to the midline involved in heart development delayed, abnormal AB + MO1-snai1b standard conditions Fig. 2 with image from Qiao et al., 2014
prechordal plate increased size, abnormal WT + MO1-snai1b standard conditions Fig. S3 with image from Blanco et al., 2007
whole organism anterior-posterior axis decreased length, abnormal WT + MO1-snai1b standard conditions Fig. 1 with image from Blanco et al., 2007
post-vent region decreased length, abnormal WT + MO1-snai1b standard conditions Fig. 1 with image from Blanco et al., 2007
polster morphology, abnormal WT + MO1-snai1b standard conditions Fig. 3 with image from Blanco et al., 2007
polster increased length, abnormal WT + MO1-snai1b standard conditions Fig. 3 with image from Blanco et al., 2007
cell-cell adhesion increased occurrence, abnormal WT + MO1-snai1b standard conditions Fig. 5 with image from Blanco et al., 2007
somite shape, abnormal WT + MO1-snai1b standard conditions Fig. 2 with image from Blanco et al., 2007
prechordal plate elongated, abnormal WT + MO1-snai1b standard conditions Fig. 7 with image from Blanco et al., 2007
cell migration involved in gastrulation decreased rate, abnormal WT + MO1-snai1b standard conditions Fig. 5 with image from Blanco et al., 2007
convergent extension involved in axis elongation disrupted, abnormal WT + MO1-snai1b standard conditions Fig. 1 with image from Blanco et al., 2007
prechordal plate shape, abnormal WT + MO1-snai1b standard conditions Fig. S3 with image from Blanco et al., 2007
trunk decreased length, abnormal WT + MO1-snai1b standard conditions Fig. 1 with image from Blanco et al., 2007
cardiac ventricle decreased size, abnormal twu34Tg + MO1-snai1b standard conditions Fig. 1 with image from Qiao et al., 2014
atrium position, abnormal twu34Tg + MO1-snai1b standard conditions Fig. 1 with image from Qiao et al., 2014
heart looping process quality, abnormal twu34Tg + MO1-snai1b standard conditions Fig. 1 with image from Qiao et al., 2014
posterior lateral line primordium posterior region etv4 expression decreased amount, abnormal zf106Tg + MO1-snai1b standard conditions Fig. 5 with image from Neelathi et al., 2018
posterior lateral line primordium anterior region cxcr4b expression increased amount, abnormal zf106Tg + MO1-snai1b standard conditions Fig. 5 with image from Neelathi et al., 2018
posterior lateral line primordium posterior lateral line neuromast primordium migration decreased rate, abnormal zf106Tg + MO1-snai1b standard conditions Fig. 3 with image,  Fig. 4 with image from Neelathi et al., 2018
posterior lateral line primordium posterior lateral line neuromast deposition delayed, abnormal zf106Tg + MO1-snai1b standard conditions Fig. 3 with image from Neelathi et al., 2018
posterior lateral line primordium posterior region lef1 expression mislocalised, abnormal zf106Tg + MO1-snai1b standard conditions Fig. 5 with image from Neelathi et al., 2018
posterior lateral line primordium anterior region etv4 expression decreased amount, abnormal zf106Tg + MO1-snai1b standard conditions Fig. 5 with image from Neelathi et al., 2018
posterior lateral line primordium anterior region ackr3b expression increased amount, abnormal zf106Tg + MO1-snai1b standard conditions Fig. 5 with image from Neelathi et al., 2018
posterior lateral line primordium anterior region lef1 expression increased amount, abnormal zf106Tg + MO1-snai1b standard conditions Fig. 5 with image from Neelathi et al., 2018
posterior lateral line has fewer parts of type posterior lateral line neuromast, abnormal zf106Tg + MO1-snai1b standard conditions Fig. 3 with image from Neelathi et al., 2018
posterior lateral line primordium central region lef1 expression mislocalised, abnormal zf106Tg + MO1-snai1b standard conditions Fig. 5 with image from Neelathi et al., 2018
posterior lateral line primordium posterior region lef1 expression increased distribution, abnormal zf106Tg + MO1-snai1b standard conditions Fig. 5 with image from Neelathi et al., 2018
posterior lateral line primordium central region cxcr4b expression increased amount, abnormal zf106Tg + MO1-snai1b standard conditions Fig. 5 with image from Neelathi et al., 2018
posterior lateral line primordium posterior region lef1 expression increased amount, abnormal zf106Tg + MO1-snai1b standard conditions Fig. 5 with image from Neelathi et al., 2018
posterior lateral line primordium posterior region epcam expression increased amount, abnormal zf106Tg + MO1-snai1b standard conditions Fig. 4 with image from Neelathi et al., 2018
posterior lateral line primordium anterior region ackr3b expression decreased amount, abnormal zf106Tg + MO1-snai1b standard conditions Fig. 5 with image from Neelathi et al., 2018
posterior lateral line primordium anterior region ackr3b expression mislocalised, abnormal zf106Tg + MO1-snai1b standard conditions Fig. 5 with image from Neelathi et al., 2018
posterior lateral line primordium central region cxcr4b expression mislocalised, abnormal zf106Tg + MO1-snai1b standard conditions Fig. 5 with image from Neelathi et al., 2018
posterior lateral line primordium central region lef1 expression increased amount, abnormal zf106Tg + MO1-snai1b standard conditions Fig. 5 with image from Neelathi et al., 2018
posterior lateral line primordium central region etv4 expression decreased amount, abnormal zf106Tg + MO1-snai1b standard conditions Fig. 5 with image from Neelathi et al., 2018
posterior lateral line primordium posterior region cdh2 expression decreased amount, abnormal zf106Tg + MO1-snai1b standard conditions Fig. 4 with image from Neelathi et al., 2018
posterior lateral line primordium anterior region cxcr4b expression mislocalised, abnormal zf106Tg + MO1-snai1b standard conditions Fig. 5 with image from Neelathi et al., 2018
posterior lateral line primordium anterior region ackr3b expression decreased distribution, abnormal zf106Tg + MO1-snai1b standard conditions Fig. 5 with image from Neelathi et al., 2018
posterior lateral line primordium anterior region lef1 expression mislocalised, abnormal zf106Tg + MO1-snai1b standard conditions Fig. 5 with image from Neelathi et al., 2018
prechordal plate mislocalised posteriorly, abnormal WT + MO1-snai1b + MO2-snai1a + MO3-snai1a standard conditions Fig. 7 with image from Blanco et al., 2007
prechordal plate elongated, abnormal WT + MO1-snai1b + MO2-snai1a + MO3-snai1a standard conditions Fig. 7 with image from Blanco et al., 2007
posterior lateral line primordium posterior lateral line neuromast primordium migration rate, ameliorated zf106Tg + MO1-epcam + MO1-snai1b standard conditions Fig. 4 with image from Neelathi et al., 2018
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.