Morpholino

MO1-llgl2

ID
ZDB-MRPHLNO-050817-1
Name
MO1-llgl2
Previous Names
  • lgl2MO (1)
Target
Sequence
5' - GCCCATGACGCCTGAACCTCTTCAT - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-llgl2
No data available
Phenotype
Phenotype resulting from MO1-llgl2
Phenotype Fish Figures
brain hydrocephalic, abnormal AB/TU + MO1-llgl2 Fig. 1 with image from Tay et al., 2013
brain elovl6 expression spatial pattern, abnormal AB/TU + MO1-llgl2 Fig. 7 with image from Ji et al., 2016
brain right side elovl6 expression mislocalised, abnormal AB/TU + MO1-llgl2 Fig. 7 with image from Ji et al., 2016
determination of heart left/right asymmetry decreased process quality, abnormal AB/TU + MO1-llgl2 Fig. 3 with image from Tay et al., 2013
determination of left/right asymmetry in nervous system disrupted, abnormal AB/TU + MO1-llgl2 Fig. 7 with image from Ji et al., 2016
eye photoreceptor cell alignment eye photoreceptor cell, abnormal llgl2to6/+ + MO1-llgl2 Fig. 5 with image from Kujawski et al., 2019
eye photoreceptor cell mislocalised, abnormal llgl2to6/to6 + MO1-llgl2 Fig. 6 with image from Kujawski et al., 2019
heart symmetry, abnormal twu34Tg + MO1-llgl2 Fig. 3 with image from Tay et al., 2013
heart looping decreased process quality, abnormal twu34Tg + MO1-llgl2 Fig. 3 with image from Tay et al., 2013
Kupffer's vesicle decreased area, abnormal s870Tg + MO1-llgl2 Fig. 2 with image from Tay et al., 2013
Kupffer's vesicle decreased volume, abnormal AB/TU + MO1-llgl2 Fig. 1 with image from Tay et al., 2013
Kupffer's vesicle has fewer parts of type Kupffer's vesicle motile cilium, abnormal AB/TU + MO1-llgl2 Fig. 1 with imageFig. 2 with image from Tay et al., 2013
Kupffer's vesicle basolateral plasma membrane physical object quality, abnormal pt19Tg + MO1-llgl2 Fig. 4 with image from Tay et al., 2013
Kupffer's vesicle motile cilium decreased length, abnormal AB/TU + MO1-llgl2 Fig. 1 with imageFig. 2 with image from Tay et al., 2013
Kupffer's vesicle motile cilium assembly decreased process quality, abnormal AB/TU + MO1-llgl2 Fig. 1 with image from Tay et al., 2013
Kupffer's vesicle development decreased process quality, abnormal AB/TU + MO1-llgl2 Fig. 1 with image from Tay et al., 2013
lateral plate mesoderm bilateral symmetry, abnormal AB/TU + MO1-llgl2 Fig. 3 with image from Tay et al., 2013
left/right pattern formation disrupted, abnormal AB/TU + MO1-llgl2 Fig. 7 with image from Ji et al., 2016
otic vesicle decreased volume, abnormal AB/TU + MO1-llgl2 Fig. 1 with image from Tay et al., 2013
otic vesicle has fewer parts of type otic vesicle motile cilium, abnormal AB/TU + MO1-llgl2 Fig. 1 with image from Tay et al., 2013
otic vesicle motile cilium decreased length, abnormal AB/TU + MO1-llgl2 Fig. 1 with image from Tay et al., 2013
otic vesicle motile cilium assembly decreased process quality, abnormal AB/TU + MO1-llgl2 Fig. 1 with image from Tay et al., 2013
outer limiting membrane morphology, abnormal llgl2to6/to6 + MO1-llgl2 Fig. 7 with image from Kujawski et al., 2019
post-vent region curved ventral, abnormal AB/TU + MO1-llgl2 Fig. 1 with image from Tay et al., 2013
pronephric duct motile cilium decreased length, abnormal AB/TU + MO1-llgl2 Fig. 1 with image from Tay et al., 2013
pronephric duct motile cilium disorganized, abnormal AB/TU + MO1-llgl2 Fig. 1 with image from Tay et al., 2013
pronephric duct morphogenesis decreased process quality, abnormal AB/TU + MO1-llgl2 Fig. 1 with image from Tay et al., 2013
retina morphology, abnormal llgl2to6/to6 + MO1-llgl2 Fig. 6 with image from Kujawski et al., 2019
retinal inner nuclear layer morphology, abnormal llgl2to6/to6 + MO1-llgl2 Fig. 6 with image from Kujawski et al., 2019
retinal inner nuclear layer cell mislocalised, abnormal llgl2to6/to6 + MO1-llgl2 Fig. 6 with image from Kujawski et al., 2019
retinal outer nuclear layer morphology, abnormal llgl2to6/to6 + MO1-llgl2 Fig. 5 with image from Kujawski et al., 2019
retinal photoreceptor layer disorganized, abnormal llgl2to6/to6 + MO1-llgl2 Fig. 7 with image from Kujawski et al., 2019
retinal photoreceptor layer morphology, abnormal llgl2to6/to6 + MO1-llgl2 Fig. 5 with imageFig. 6 with image from Kujawski et al., 2019
Phenotype of all Fish created by or utilizing MO1-llgl2
Phenotype Fish Conditions Figures
eye photoreceptor cell alignment eye photoreceptor cell, abnormal llgl2to6/to6 + MO1-llgl2 standard conditions Fig. 5 with image from Kujawski et al., 2019
retinal outer nuclear layer morphology, abnormal llgl2to6/to6 + MO1-llgl2 standard conditions Fig. 5 with image from Kujawski et al., 2019
retina morphology, abnormal llgl2to6/to6 + MO1-llgl2 standard conditions Fig. 6 with image from Kujawski et al., 2019
eye photoreceptor cell mislocalised, abnormal llgl2to6/to6 + MO1-llgl2 standard conditions Fig. 6 with image from Kujawski et al., 2019
retinal photoreceptor layer disorganized, abnormal llgl2to6/to6 + MO1-llgl2 standard conditions Fig. 7 with image from Kujawski et al., 2019
retinal inner nuclear layer cell mislocalised, abnormal llgl2to6/to6 + MO1-llgl2 standard conditions Fig. 6 with image from Kujawski et al., 2019
retinal photoreceptor layer morphology, abnormal llgl2to6/to6 + MO1-llgl2 standard conditions Fig. 5 with imageFig. 6 with image from Kujawski et al., 2019
outer limiting membrane morphology, abnormal llgl2to6/to6 + MO1-llgl2 standard conditions Fig. 7 with image from Kujawski et al., 2019
retinal inner nuclear layer morphology, abnormal llgl2to6/to6 + MO1-llgl2 standard conditions Fig. 6 with image from Kujawski et al., 2019
left/right pattern formation disrupted, abnormal AB/TU + MO1-llgl2 standard conditions Fig. 7 with image from Ji et al., 2016
Kupffer's vesicle decreased volume, abnormal AB/TU + MO1-llgl2 standard conditions Fig. 1 with image from Tay et al., 2013
otic vesicle has fewer parts of type otic vesicle motile cilium, abnormal AB/TU + MO1-llgl2 standard conditions Fig. 1 with image from Tay et al., 2013
pronephric duct motile cilium disorganized, abnormal AB/TU + MO1-llgl2 standard conditions Fig. 1 with image from Tay et al., 2013
brain right side elovl6 expression mislocalised, abnormal AB/TU + MO1-llgl2 standard conditions Fig. 7 with image from Ji et al., 2016
Kupffer's vesicle motile cilium assembly decreased process quality, abnormal AB/TU + MO1-llgl2 standard conditions Fig. 1 with image from Tay et al., 2013
pronephric duct morphogenesis decreased process quality, abnormal AB/TU + MO1-llgl2 standard conditions Fig. 1 with image from Tay et al., 2013
brain hydrocephalic, abnormal AB/TU + MO1-llgl2 standard conditions Fig. 1 with image from Tay et al., 2013
otic vesicle motile cilium decreased length, abnormal AB/TU + MO1-llgl2 standard conditions Fig. 1 with image from Tay et al., 2013
brain elovl6 expression spatial pattern, abnormal AB/TU + MO1-llgl2 standard conditions Fig. 7 with image from Ji et al., 2016
Kupffer's vesicle has fewer parts of type Kupffer's vesicle motile cilium, abnormal AB/TU + MO1-llgl2 standard conditions Fig. 1 with image from Tay et al., 2013
otic vesicle decreased volume, abnormal AB/TU + MO1-llgl2 standard conditions Fig. 1 with image from Tay et al., 2013
otic vesicle motile cilium assembly decreased process quality, abnormal AB/TU + MO1-llgl2 standard conditions Fig. 1 with image from Tay et al., 2013
Kupffer's vesicle development decreased process quality, abnormal AB/TU + MO1-llgl2 standard conditions Fig. 1 with image from Tay et al., 2013
determination of left/right asymmetry in nervous system disrupted, abnormal AB/TU + MO1-llgl2 standard conditions Fig. 7 with image from Ji et al., 2016
determination of heart left/right asymmetry decreased process quality, abnormal AB/TU + MO1-llgl2 standard conditions Fig. 3 with image from Tay et al., 2013
Kupffer's vesicle motile cilium decreased length, abnormal AB/TU + MO1-llgl2 standard conditions Fig. 1 with image from Tay et al., 2013
pronephric duct motile cilium decreased length, abnormal AB/TU + MO1-llgl2 standard conditions Fig. 1 with image from Tay et al., 2013
lateral plate mesoderm bilateral symmetry, abnormal AB/TU + MO1-llgl2 standard conditions Fig. 3 with image from Tay et al., 2013
post-vent region curved ventral, abnormal AB/TU + MO1-llgl2 standard conditions Fig. 1 with image from Tay et al., 2013
eye photoreceptor cell alignment eye photoreceptor cell, abnormal llgl2to6/+ + MO1-llgl2 standard conditions Fig. 5 with image from Kujawski et al., 2019
retinal outer nuclear layer morphology, abnormal llgl2to6/+ + MO1-llgl2 standard conditions Fig. 5 with image from Kujawski et al., 2019
retinal photoreceptor layer morphology, abnormal llgl2to6/+ + MO1-llgl2 standard conditions Fig. 5 with image from Kujawski et al., 2019
Kupffer's vesicle basolateral plasma membrane physical object quality, abnormal pt19Tg + MO1-llgl2 standard conditions Fig. 4 with image from Tay et al., 2013
Kupffer's vesicle motile cilium decreased length, abnormal s870Tg + MO1-llgl2 standard conditions Fig. 2 with image from Tay et al., 2013
Kupffer's vesicle has fewer parts of type Kupffer's vesicle motile cilium, abnormal s870Tg + MO1-llgl2 standard conditions Fig. 2 with image from Tay et al., 2013
Kupffer's vesicle decreased area, abnormal s870Tg + MO1-llgl2 standard conditions Fig. 2 with image from Tay et al., 2013
heart looping decreased process quality, abnormal twu34Tg + MO1-llgl2 standard conditions Fig. 3 with image from Tay et al., 2013
heart symmetry, abnormal twu34Tg + MO1-llgl2 standard conditions Fig. 3 with image from Tay et al., 2013
Kupffer's vesicle anatomical space decreased volume, abnormal a131Tg; sny120Tg + MO1-llgl2 + MO4-tp53 chemical treatment by environment: afimoxifene Fig. 6 with image from Dasgupta et al., 2018
ventral fin fold malformed, abnormal AB + MO1-llgl2 + MO2-clint1a standard conditions Fig. 6 with image from Dodd et al., 2009
epidermis malformed, abnormal AB + MO1-llgl2 + MO2-clint1a standard conditions Fig. 6 with image from Dodd et al., 2009
keratinocyte ab5-akt labeling amount, ameliorated AB + MO1-llgl2 + MO6-pax2a hypotonic, chemical treatment by environment: LY294002 Fig 7 with image from Hatzold et al., 2023
epidermis potentially cancerous lesions amount, ameliorated AB + MO1-llgl2 + MO6-pax2a hypotonic, chemical treatment by environment: sirolimus Fig 7 with image from Hatzold et al., 2023
keratinocyte ab5-akt labeling spatial pattern, abnormal AB + MO1-llgl2 + MO6-pax2a hypotonic Fig 7 with image from Hatzold et al., 2023
keratinocyte ab5-akt labeling spatial pattern, ameliorated AB + MO1-llgl2 + MO6-pax2a hypotonic, chemical treatment by environment: LY294002 Fig 7 with image from Hatzold et al., 2023
epidermis potentially cancerous lesions amount, ameliorated AB + MO1-llgl2 + MO6-pax2a hypotonic, chemical treatment by environment: wortmannin Fig 7 with image from Hatzold et al., 2023
epidermis mmp9 expression amount, ameliorated AB + MO1-llgl2 + MO6-pax2a hypotonic, chemical treatment by environment: sirolimus Fig 7 with image from Hatzold et al., 2023
epidermis mmp9 expression amount, ameliorated AB + MO1-llgl2 + MO6-pax2a hypotonic, chemical treatment by environment: LY294002 Fig 7 with image from Hatzold et al., 2023
epidermis potentially cancerous lesions increased amount, exacerbated AB + MO1-llgl2 + MO6-pax2a hypotonic Fig 7 with image from Hatzold et al., 2023
epidermis potentially cancerous lesions amount, ameliorated AB + MO1-llgl2 + MO6-pax2a hypotonic, chemical treatment by environment: LY294002 Fig 7 with image from Hatzold et al., 2023
keratinocyte ab5-akt labeling increased amount, abnormal AB + MO1-llgl2 + MO6-pax2a hypotonic Fig 7 with image from Hatzold et al., 2023
epidermis mmp9 expression increased amount, abnormal AB + MO1-llgl2 + MO6-pax2a hypotonic Fig 7 with image from Hatzold et al., 2023
epidermis morphology, abnormal WT + MO1-llgl2 + MO2-atp1b1a standard conditions Fig. 7 with image from Hatzold et al., 2016
epidermal cell aggregated, abnormal WT + MO1-llgl2 + MO2-atp1b1a standard conditions Fig. 7 with image from Hatzold et al., 2016
Kupffer's vesicle basolateral plasma membrane physical object quality, abnormal pt19Tg + MO1-llgl2 + MO1-rab11a standard conditions Fig. 6 with image from Tay et al., 2013
Kupffer's vesicle development decreased process quality, abnormal s870Tg + MO1-llgl2 + MO1-rab11a standard conditions Fig. 5 with image from Tay et al., 2013
Kupffer's vesicle decreased volume, abnormal s870Tg + MO1-llgl2 + MO1-rab11a standard conditions Fig. 5 with image from Tay et al., 2013
Citations