Morpholino
MO1-llgl2
- ID
- ZDB-MRPHLNO-050817-1
- Name
- MO1-llgl2
- Previous Names
-
- lgl2MO (1)
- Target
- Sequence
-
5' - GCCCATGACGCCTGAACCTCTTCAT - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
- None
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-llgl2
No data available
Phenotype
Phenotype resulting from MO1-llgl2
1 - 5 of 33 Show all
Phenotype of all Fish created by or utilizing MO1-llgl2
1 - 5 of 57 Show all
Citations
- Hatzold, J., Nett, V., Brantsch, S., Zhang, J.L., Armistead, J., Wessendorf, H., Stephens, R., Humbert, P.O., Iden, S., Hammerschmidt, M. (2023) Matriptase-dependent epidermal pre-neoplasm in zebrafish embryos caused by a combination of hypotonic stress and epithelial polarity defects. PLoS Genetics. 19:e1010873e1010873
- Kujawski, S., Sonawane, M., Knust, E. (2019) penner/lgl2 is required for the integrity of the photoreceptor layer in the zebrafish retina. Biology Open. 8(4):
- Dasgupta, A., Merkel, M., Clark, M.J., Jacob, A.E., Dawson, J.E., Manning, M.L., Amack, J.D. (2018) Cell volume changes contribute to epithelial morphogenesis in zebrafish Kupffer's vesicle. eLIFE. 7
- Hatzold, J., Beleggia, F., Herzig, H., Altmüller, J., Nürnberg, P., Bloch, W., Wollnik, B., Hammerschmidt, M. (2016) Tumor suppression in basal keratinocytes via dual non-cell-autonomous functions of a Na,K-ATPase beta subunit. eLIFE. 5:e14277
- Ji, Y., Buel, S.M., Amack, J.D. (2016) Mutations in zebrafish pitx2 model congenital malformations in Axenfeld-Rieger syndrome but do not disrupt left-right placement of visceral organs. Developmental Biology. 416(1):69-81
- Westcot, S.E., Hatzold, J., Urban, M.D., Richetti, S.K., Skuster, K.J., Harm, R.M., Lopez Cervera, R., Umemoto, N., McNulty, M.S., Clark, K.J., Hammerschmidt, M., Ekker, S.C. (2015) Protein-Trap Insertional Mutagenesis Uncovers New Genes Involved in Zebrafish Skin Development, Including a Neuregulin 2a-Based ErbB Signaling Pathway Required during Median Fin Fold Morphogenesis. PLoS One. 10:e0130688
- Tay, H.G., Schulze, S.K., Compagnon, J., Foley, F.C., Heisenberg, C.P., Yost, H.J., Abdelilah-Seyfried, S., and Amack, J.D. (2013) Lethal giant larvae 2 regulates development of the ciliated organ Kupffer's vesicle. Development (Cambridge, England). 140(7):1550-1559
- Dodd, M.E., Hatzold, J., Mathias, J.R., Walters, K.B., Bennin, D.A., Rhodes, J., Kanki, J.P., Look, A.T., Hammerschmidt, M., and Huttenlocher, A. (2009) The ENTH domain protein Clint1 is required for epidermal homeostasis in zebrafish. Development (Cambridge, England). 136(15):2591-2600
- Hava, D., Forster, U., Matsuda, M., Cui, S., Link, B.A., Eichhorst, J., Wiesner, B., Chitnis, A., and Abdelilah-Seyfried, S. (2009) Apical membrane maturation and cellular rosette formation during morphogenesis of the zebrafish lateral line. Journal of Cell Science. 122(Pt 5):687-695
- Sonawane, M., Martin-Maischein, H., Schwarz, H., and Nüsslein-Volhard, C. (2009) Lgl2 and E-cadherin act antagonistically to regulate hemidesmosome formation during epidermal development in zebrafish. Development (Cambridge, England). 136(8):1231-1240
1 - 10 of 11
Show