CRISPR

CRISPR5-atp11a

ID

ZDB-CRISPR-250812-3

Name

CRISPR5-atp11a

Previous Names

None

Target

atp11a (1)

Sequence

5' - GAGTACTACTTGTTCTGTAA - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Constructs

No data available

Genomic Features

Genomic Feature	Affected Genomic Regions
nfl1005	atp11a
nfl1007	atp11a

Expression

Gene expression in Wild Types + CRISPR5-atp11a

No data available

Phenotype

Phenotype resulting from CRISPR5-atp11a

No data available

Phenotype of all Fish created by or utilizing CRISPR5-atp11a

Phenotype	Fish	Conditions	Figures
posterior macula stereocilium decreased amount, abnormal	atp11a^{nfl1005/nfl1005} (AB)	standard conditions	Fig. 2 from Hawkey-Noble et al., 2025
whole organism dead, abnormal	atp11a^{nfl1005/nfl1005} (AB)	standard conditions	text only from Hawkey-Noble et al., 2025
lateral crista stereocilium decreased amount, abnormal	atp11a^{nfl1005/nfl1005} (AB)	standard conditions	Fig. 2 from Hawkey-Noble et al., 2025
head decreased pigmentation, abnormal	atp11a^{nfl1005/nfl1005} (AB)	standard conditions	Fig. 1 from Hawkey-Noble et al., 2025
posterior crista stereocilium decreased amount, abnormal	atp11a^{nfl1005/nfl1005} (AB)	standard conditions	Fig. 2 from Hawkey-Noble et al., 2025
anterior macula stereocilium decreased amount, abnormal	atp11a^{nfl1005/nfl1005} (AB)	standard conditions	Fig. 2 from Hawkey-Noble et al., 2025
eye photoreceptor cell mitochondrion amount, ameliorated	atp11a^{nfl1007/nfl1007} (AB)	lighting conditions	Fig. 5 from Hawkey-Noble et al., 2025
otic lateral line neuromast neuromast hair cell decreased amount, abnormal	atp11a^{nfl1007/nfl1007} (AB)	standard conditions	Fig. 3 from Hawkey-Noble et al., 2025
photoreceptor outer segment layer photoreceptor outer segment length, ameliorated	atp11a^{nfl1007/nfl1007} (AB)	lighting conditions	Fig. 5 from Hawkey-Noble et al., 2025
photoreceptor outer segment layer photoreceptor outer segment decreased amount, abnormal	atp11a^{nfl1007/nfl1007} (AB)	lighting conditions	Fig. 5 from Hawkey-Noble et al., 2025
photoreceptor outer segment layer decreased size, abnormal	atp11a^{nfl1007/nfl1007} (AB)	lighting conditions	Fig. 4 from Hawkey-Noble et al., 2025
photoreceptor outer segment layer photoreceptor outer segment amount, ameliorated	atp11a^{nfl1007/nfl1007} (AB)	lighting conditions	Fig. 5 from Hawkey-Noble et al., 2025
photoreceptor outer segment layer size, ameliorated	atp11a^{nfl1007/nfl1007} (AB)	lighting conditions	Fig. 4 from Hawkey-Noble et al., 2025
swimming behavior decreased process quality, abnormal	atp11a^{nfl1007/nfl1007} (AB)	altered light dark cycle	Fig. 7 from Hawkey-Noble et al., 2025
whole organism dead, abnormal	atp11a^{nfl1007/nfl1007} (AB)	standard conditions	text only from Hawkey-Noble et al., 2025
eye photoreceptor cell mitochondrion increased amount, abnormal	atp11a^{nfl1007/nfl1007} (AB)	lighting conditions	Fig. 5 from Hawkey-Noble et al., 2025
head atp11a expression decreased distribution, abnormal	atp11a^{nfl1007/nfl1007} (AB)	standard conditions	Fig. 1 from Hawkey-Noble et al., 2025
head decreased pigmentation, abnormal	atp11a^{nfl1007/nfl1007} (AB)	standard conditions	Fig. 1 from Hawkey-Noble et al., 2025
photoreceptor outer segment layer photoreceptor outer segment decreased length, abnormal	atp11a^{nfl1007/nfl1007} (AB)	lighting conditions	Fig. 5 from Hawkey-Noble et al., 2025
eye cell death increased process quality, abnormal	atp11a^{nfl1007/nfl1007} (AB)	lighting conditions	Fig. 6 from Hawkey-Noble et al., 2025
eye cell death increased process quality, abnormal	atp11a^{nfl1007/nfl1007} (AB)	lighting conditions	Fig. 6 from Hawkey-Noble et al., 2025
lateral crista stereocilium decreased amount, abnormal	atp11a^nfl1005/+ (AB)	standard conditions	Fig. 2 from Hawkey-Noble et al., 2025
posterior crista stereocilium decreased amount, abnormal	atp11a^nfl1005/+ (AB)	standard conditions	Fig. 2 from Hawkey-Noble et al., 2025
posterior macula stereocilium decreased amount, abnormal	atp11a^nfl1005/+ (AB)	standard conditions	Fig. 2 from Hawkey-Noble et al., 2025
otic lateral line neuromast neuromast hair cell decreased amount, abnormal	atp11a^nfl1007/+ (AB)	standard conditions	Fig. 3 from Hawkey-Noble et al., 2025

Citations