CRISPR

CRISPR1-insm1a

ID

ZDB-CRISPR-170113-5

Name

CRISPR1-insm1a

Previous Names

Target

Sequence

5' - GGAACCCCGAGACAGTCTACCGG - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Constructs

No data available

Genomic Features

Genomic Feature	Affected Genomic Regions
nju54	insm1a

Expression

Gene expression in Wild Types + CRISPR1-insm1a

No data available

Phenotype

Phenotype resulting from CRISPR1-insm1a

Phenotype	Fish	Figures
CaP motoneuron decreased amount, abnormal	ml2Tg + CRISPR1-insm1a	Fig. 2 , Fig. S3 from Gong et al., 2017
CaP motoneuron distance CaP motoneuron, abnormal	ml2Tg + CRISPR1-insm1a	Fig. 2 from Gong et al., 2017
CaP motoneuron axon decreased length, abnormal	ml2Tg + CRISPR1-insm1a	Fig. 2 from Gong et al., 2017
CaP motoneuron axon increased branchiness, abnormal	ml2Tg + CRISPR1-insm1a	Fig. 2 from Gong et al., 2017
MiP motor neuron decreased amount, abnormal	ml2Tg + CRISPR1-insm1a	Fig. 2 , Fig. S3 from Gong et al., 2017
neuron undifferentiated, abnormal	ml2Tg + CRISPR1-insm1a	Fig. 3 from Gong et al., 2017
neuron differentiation decreased process quality, abnormal	ml2Tg + CRISPR1-insm1a	Fig. 3 from Gong et al., 2017
swimming decreased occurrence, abnormal	ml2Tg + CRISPR1-insm1a	Fig. 4 from Gong et al., 2017
swimming decreased rate, abnormal	ml2Tg + CRISPR1-insm1a	Fig. 4 from Gong et al., 2017
swimming behavior decreased process quality, abnormal	ml2Tg + CRISPR1-insm1a	Fig. 4 from Gong et al., 2017
thigmotaxis decreased process quality, abnormal	ml2Tg + CRISPR1-insm1a	text only from Gong et al., 2017
whole organism decreased life span, abnormal	ml2Tg + CRISPR1-insm1a	Fig. S2 from Gong et al., 2017

Phenotype of all Fish created by or utilizing CRISPR1-insm1a

Phenotype	Fish	Conditions	Figures
CaP motoneuron distance CaP motoneuron, abnormal	ml2Tg + CRISPR1-insm1a	standard conditions	Fig. 2 from Gong et al., 2017
MiP motor neuron decreased amount, abnormal	ml2Tg + CRISPR1-insm1a	standard conditions	Fig. 2 , Fig. S3 from Gong et al., 2017
CaP motoneuron axon decreased length, abnormal	ml2Tg + CRISPR1-insm1a	standard conditions	Fig. 2 from Gong et al., 2017
thigmotaxis decreased process quality, abnormal	ml2Tg + CRISPR1-insm1a	standard conditions	text only from Gong et al., 2017
neuron undifferentiated, abnormal	ml2Tg + CRISPR1-insm1a	standard conditions	Fig. 3 from Gong et al., 2017
CaP motoneuron decreased amount, abnormal	ml2Tg + CRISPR1-insm1a	standard conditions	Fig. 2 , Fig. S3 from Gong et al., 2017
CaP motoneuron axon increased branchiness, abnormal	ml2Tg + CRISPR1-insm1a	standard conditions	Fig. 2 from Gong et al., 2017
whole organism decreased life span, abnormal	ml2Tg + CRISPR1-insm1a	standard conditions	Fig. S2 from Gong et al., 2017
swimming decreased rate, abnormal	ml2Tg + CRISPR1-insm1a	standard conditions	Fig. 4 from Gong et al., 2017
swimming decreased occurrence, abnormal	ml2Tg + CRISPR1-insm1a	standard conditions	Fig. 4 from Gong et al., 2017
neuron differentiation decreased process quality, abnormal	ml2Tg + CRISPR1-insm1a	standard conditions	Fig. 3 from Gong et al., 2017
swimming behavior decreased process quality, abnormal	ml2Tg + CRISPR1-insm1a	standard conditions	Fig. 4 from Gong et al., 2017

Citations