Genomic Feature

nju54

ID
ZDB-ALT-170113-9
Name
nju54
Synonyms
None
Affected Genomic Region
Construct
None
Type
Allele with one deletion (1)
Protocol
embryos treated with
Lab of Origin
Zhao Lab
Current Source
China Zebrafish Resource Center (CZRC)    (order this)
Other Pages
Notes
No data available
Genome Browser
Variants
Variant Type
Small Deletion
Variant Location
Chr 20: 48485113 - 48485122 (GRCz11) (1) Details
Nucleotide change
CATAGCCCGG/-
Variant Notes
CCGGGCTATG is deleted
Effect on DNA/cDNA, transcript, protein (from publications)
DNA/cDNA Change
10 bp deleted from position 162 to 171 (1)
Transcript Consequence
None
Protein Consequence
None
Sequences
Flanking Sequence
AGGTTCGCCGGGCAGCTGAAGAGCTTGTCGCATTCGGGACATCTGTACTCGATCCTGACGATCCTGGAGCATTTGTGCTGGGCTAGAGAGAAGGGGTCCGCGTATGCCTCTCTGCACAGCTGACAGACGAACTCTCCGAGCGGCTTGTCTCCGCTTGCGCACTGCGATCTGGGCTTCTGCTCCACCGGACCTTCTTTGATCTTCAGTCCGAGCACTGGAGAGGTGGTCATCTCATCCTCGAACTGCAGCTTCCGCATGGCTTTGGCTTTCTTGGATGCCGGTTTGCCTTTGCGCTCTGTGTCGGACGCGGGTCTTTTGGTGGTTACTGTGGTGCCGGTTCGGTTGCTGTTGCTGGTGCCGATTTTAAGATCCACCGGCGCTTGGTCGGAGCAGTTTGGCGCCGCCGGGAAAGACTCCGCTGAGATGGGCGAGCCGAGATTAAAGCGCCGCTCCAAACACGCCCTCTCGTGCTCTCTGCTGACGGGACGCGTCGGGCTGTA
CATAGCCCGG/- TAGACTGTCTCGGGGTTCCCGAACTGCACGGGTGACACCGGGCGGCGCGCGCACGGAACATCCTGCGCGACAAACGCGCCCTGCTCGTCCTCCTCCGAGCGGACCCGGTACGAAACAGGTGTCGCTTTCTTATTTCGCTTGACTAAAAATCCTCTGGGCATCTTCGCCAGCTGAAAGGCACTTCAGTCGGGTTGAAATCAGAGGCACACCTGGTACTATATTTGGACGCGCGCGGTGATCTTTCCATCACGAAAGCATAGCGGCAGTCTTTTTAAGCAGGAATGATGACATTGTTCTCGCCCCTCGCCGGATCGTCCAATCAGATGGAGCTGAATCCCTATGGATTCGGGGATGGGAGGGTCTGCAGATTGCTCGGGCAGATGTACCTGAGCTTTATTATATTAGGATGCTTTAGGCACACGCTGGTTCCTCCTCTTTTCACGCTTTGATGCTTCCCGTCAATGCGCACGTGCCCTGCCTTTGTCAGCATCCTTTAGGGG
Additional Sequence
None
Fish
Supplemental Information
Genotyping protocol
None
Citations