| ZFIN ID: ZDB-GENE-980526-112 |
| Gene Name: | ISL LIM homeobox 1a |
|---|---|
| Symbol: | isl1a |
PHYSICAL MAP AND BROWSER
|
|
||||||||||||||||||||||||||||
|
| Mapped Clones containing isl1a | |
|---|---|
| CH211-219F7 | Chr: 5 Details |
PHYSICAL MAPPING
| Feature | Chr | Position | Assembly | Source | DetailedSource | Citations |
|---|---|---|---|---|---|---|
| rw436 | 5 | 40,730,696 | GRCz11 | DIRECT | Tanaka et al., 2011 | |
| sa29 | 5 | 40,732,319 | GRCz11 | DIRECT | de Pater et al., 2009 | |
| rw436 | 5 | GRCz11 | OTHER_MAPPING | linkagesDirectMem2 | ||
| 5 | GRCz11 | OTHER_MAPPING | Feature location obtained from related gene that has mapped_marker info | |||
| 5 | GRCz11 | OTHER_MAPPING | featureLocationPullThruFromGenePaneledMarkers | |||
| 5 | GRCz11 | OTHER_MAPPING | linkagesDirectMem1 | |||
| sa29 | 5 | GRCz11 | OTHER_MAPPING | Feature location obtained from related gene that has mapped_marker info | ||
| 5 | GRCz11 | OTHER_MAPPING | featureLocationPullThruFromGenePaneledMarkers |
| Chr | Location | Mapped As | Panel | Mapped By | Scoring |
|---|---|---|---|---|---|
| 5 | 108.3 cM | islet1 | Mother of Pearl (MOP) | Postlethwait, John H. | Data |
| 5 | 199.13 cR | islet1 | Loeb/NIH/5000/4000 (LN54) | Dawid, Igor B. | Data |
| 5 | 86.5 cM | isl1 | Heat Shock (HS) | Woods, Ian G. | Data |
| Note: Physical map location as
displayed in the genome browsers is more precise than linkage map location. Physical map location should be used whenever possible. |
|||||
| Genomic Feature rw436 is an allele of isl1a | ||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
||||||||||||||||||||
| Strain | Bandsize | Restriction Enzyme | Annealing Temperature [C] |
|---|---|---|---|
| SJD | 1110 | MnlI | 36.0 |
| Forward Primer | AGAGTGACATCGACCAGCCT | ||
| Reverse Primer | GGCGTTGTTCTTCCATCAGT |