ZFIN ID: ZDB-GENE-980526-562

ZFIN ID: ZDB-GENE-980526-562

Mapping Details

Gene Name:	ISL LIM homeobox 2a
Symbol:	isl2a

PHYSICAL MAP AND BROWSER

Genome Browser	Chr	Position	Assembly
ZFIN	25	35,183,457 - 35,189,436	GRCz12tu
NCBI Map Viewer	25	35,183,457 - 35,189,436	GRCz12tu
NCBI Map Viewer	25	32,746,014 - 32,752,001	GRCz11

PHYSICAL MAPPING

Feature	Chr	Position	Assembly	Source	DetailedSource	Citations
ca20	25	32,748,968 - 32,748,969	GRCz11	DIRECT		Lamont et al., 2016
ca21	25	32,748,951 - 32,748,970	GRCz11	DIRECT		Lamont et al., 2016
co7002	25	32,751,402 - 32,751,414	GRCz11	DIRECT		Moreno et al., 2018
sa24713	25	35,186,450	GRCz12tu	DIRECT		Sealy et al., 2025
	25	32,749,011	GRCz11	DIRECT		Busch-Nentwich et al., 2013
	25	32,341,947	GRCz10	DIRECT		Busch-Nentwich et al., 2013
	25	33,731,635	Zv9	DIRECT		Busch-Nentwich et al., 2013
sa24714	25	35,188,901	GRCz12tu	DIRECT		Sealy et al., 2025
	25	32,751,466	GRCz11	DIRECT		Busch-Nentwich et al., 2013
	25	32,344,402	GRCz10	DIRECT		Busch-Nentwich et al., 2013
	25	33,734,090	Zv9	DIRECT		Busch-Nentwich et al., 2013
uhm2	25	32,751,459 - 32,751,468	GRCz11	DIRECT		Witzel et al., 2017
zf3989	25	32,750,149 - 32,750,150	GRCz11	DIRECT		Yan et al., 2023
ca20	25		GRCz11	OTHER_MAPPING	Feature location obtained from related gene that has mapped_marker info
	25		GRCz11	OTHER_MAPPING	featureLocationPullThruFromGenePaneledMarkers
	25		GRCz11	OTHER_MAPPING	featureLocationPullThruFromGeneGBrowse
ca21	25		GRCz11	OTHER_MAPPING	featureLocationPullThruFromGenePaneledMarkers
	25		GRCz11	OTHER_MAPPING	featureLocationPullThruFromGeneGBrowse
	25		GRCz11	OTHER_MAPPING	Feature location obtained from related gene that has mapped_marker info
co7002	25		GRCz11	OTHER_MAPPING	featureLocationPullThruFromGenePaneledMarkers
	25		GRCz11	OTHER_MAPPING	featureLocationPullThruFromGeneGBrowse
	25		GRCz11	OTHER_MAPPING	Feature location obtained from related gene that has mapped_marker info
co7003	25		GRCz11	OTHER_MAPPING	featureLocationPullThruFromGenePaneledMarkers
	25		GRCz11	OTHER_MAPPING	featureLocationPullThruFromGeneGBrowse
	25		GRCz11	OTHER_MAPPING	Feature location obtained from related gene that has mapped_marker info
sa24713	25		GRCz11	OTHER_MAPPING	featureLocationPullThruFromGeneGBrowse
	25		GRCz11	OTHER_MAPPING	featureLocationPullThruFromGenePaneledMarkers
	25		GRCz11	OTHER_MAPPING	Feature location obtained from related gene that has mapped_marker info
sa24714	25		GRCz11	OTHER_MAPPING	featureLocationPullThruFromGenePaneledMarkers
	25		GRCz11	OTHER_MAPPING	featureLocationPullThruFromGeneGBrowse
	25		GRCz11	OTHER_MAPPING	Feature location obtained from related gene that has mapped_marker info
uhm2	25		GRCz11	OTHER_MAPPING	Feature location obtained from related gene that has mapped_marker info
	25		GRCz11	OTHER_MAPPING	featureLocationPullThruFromGenePaneledMarkers
	25		GRCz11	OTHER_MAPPING	featureLocationPullThruFromGeneGBrowse
zf3989	25		GRCz11	OTHER_MAPPING	Feature location obtained from related gene that has mapped_marker info
	25		GRCz11	OTHER_MAPPING	featureLocationPullThruFromGeneGBrowse
	25		GRCz11	OTHER_MAPPING	featureLocationPullThruFromGenePaneledMarkers

GENETIC MAPPING PANELS
Chr	Location	Mapped As	Panel	Mapped By	Scoring
25	118.8 cM	islet2	Mother of Pearl (MOP)	Postlethwait, John H.	Data
25	481.3 cR	islet2	Loeb/NIH/5000/4000 (LN54)	Dawid, Igor B.	Data
25	490.08 cR	isl2	Loeb/NIH/5000/4000 (LN54)	Johnson, Stephen L.	Data
25	3583.0 cR	isl2	Goodfellow T51 (T51)	Geisler, Robert	Data
25	75.4 cM	isl2	Heat Shock (HS)	Woods, Ian G.	Data
25	78.77 cM	isl2	Gates et al (GAT)	Talbot, William S.	Data

Note: Physical map location as displayed in the genome browsers is more precise than linkage map location. Note: Physical map location should be used whenever possible.

Markers Encoded by isl2a
fc29g02 Chr: 25 Details

Primer Sets:
Strain	Bandsize	Restriction Enzyme	Annealing Temperature [C]
SJD	1080	NlaIII	36.0
Forward Primer	CGGGGAACATTCACTCTAGC
Reverse Primer	TAATACTGTCCGAACACGCG

Genomic Feature uhm2 is an allele of isl2a