Morpholino

MO1-plxna2

ID
ZDB-MRPHLNO-150427-2
Name
MO1-plxna2
Previous Names
  • plxna2 e3i3 MO (1)
Target
Sequence
5' - AAAAGCGATGTCTTTCTCACCTTCC - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
splice MO targeted to exon 3 - intron 3 junction, verified by RT-PCR to exclude exon 3, resulting in a frameshift mutation
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-plxna2
No data available
Phenotype
Phenotype resulting from MO1-plxna2
Phenotype Fish Figures
eye decreased size, abnormal zf460Tg + MO1-plxna2 Fig. 1 with image from Emerson et al., 2017
Fig. 7 from St Clair et al., 2017
Fig. 8 with image from Ebert et al., 2014
midbrain physical object quality, abnormal WT + MO1-plxna2 Fig. 1 with image from Ebert et al., 2014
optic cup cell population proliferation decreased occurrence, abnormal zf460Tg + MO1-plxna2 Fig. 1 with image from Emerson et al., 2017
optic vesicle decreased size, abnormal zf460Tg + MO1-plxna2 Fig. 1 with image,  Fig. 2 with image,  Fig. 5 with image from Ebert et al., 2014
optic vesicle edge shape, abnormal zf460Tg + MO1-plxna2 Fig. 2 with image from Ebert et al., 2014
optic vesicle shtn1 expression increased amount, abnormal WT + MO1-plxna2 + MO4-tp53 Fig. 2 with image from Emerson et al., 2020
optic vesicle looseness, abnormal zf460Tg + MO1-plxna2 Fig. 3 with image from Ebert et al., 2014
optic vesicle GFP expression spatial pattern, abnormal zf460Tg + MO1-plxna2 Fig. 2 with image from Emerson et al., 2020
optic vesicle unstructured, abnormal zf460Tg + MO1-plxna2 Fig. 4 with image from Ebert et al., 2014
optic vesicle apoptotic process increased occurrence, abnormal zf460Tg + MO1-plxna2 Fig. 4 with image,  Fig. 5 with image from Ebert et al., 2014
optic vesicle cell mislocalised, abnormal zf460Tg + MO1-plxna2 Fig. 3 with image,  Fig. 4 with image,  Fig. 5 with image from Ebert et al., 2014
optic vesicle cell mislocalised medially, abnormal zf460Tg + MO1-plxna2 Fig. 1 with image,  Fig. 2 with image from Ebert et al., 2014
optic vesicle regionalization decreased process quality, abnormal WT + MO1-plxna2 Fig. 7 with image from Ebert et al., 2014
optic vesicle formation decreased process quality, abnormal zf460Tg + MO1-plxna2 Fig. 1 with image,  Fig. 2 with image,  Fig. 3 with image,  Fig. 5 with image from Ebert et al., 2014
whole organism dcdc2b expression increased amount, abnormal WT + MO1-plxna2 Fig. 4 with image from Emerson et al., 2017
whole organism rasl11b expression increased amount, abnormal WT + MO1-plxna2 Fig. 4 with image from Emerson et al., 2017
whole organism shtn1 expression increased amount, abnormal WT + MO1-plxna2 Fig. 4 with image from Emerson et al., 2017
whole organism mmp2 expression increased amount, abnormal WT + MO1-plxna2 Fig. 4 with image from Emerson et al., 2017
whole organism rbl2 expression increased amount, abnormal WT + MO1-plxna2 Fig. 4 with image from Emerson et al., 2017
Phenotype of all Fish created by or utilizing MO1-plxna2
Phenotype Fish Conditions Figures
optic vesicle formation decreased process quality, abnormal WT + MO1-plxna2 standard conditions Fig. 1 with image from Ebert et al., 2014
whole organism shtn1 expression increased amount, abnormal WT + MO1-plxna2 standard conditions Fig. 4 with image from Emerson et al., 2017
whole organism rbl2 expression increased amount, abnormal WT + MO1-plxna2 standard conditions Fig. 4 with image from Emerson et al., 2017
whole organism mmp2 expression increased amount, abnormal WT + MO1-plxna2 standard conditions Fig. 4 with image from Emerson et al., 2017
midbrain physical object quality, abnormal WT + MO1-plxna2 standard conditions Fig. 1 with image from Ebert et al., 2014
optic vesicle cell mislocalised medially, abnormal WT + MO1-plxna2 standard conditions Fig. 1 with image from Ebert et al., 2014
optic vesicle regionalization decreased process quality, abnormal WT + MO1-plxna2 standard conditions Fig. 7 with image from Ebert et al., 2014
whole organism rasl11b expression increased amount, abnormal WT + MO1-plxna2 standard conditions Fig. 4 with image from Emerson et al., 2017
optic vesicle decreased size, abnormal WT + MO1-plxna2 standard conditions Fig. 1 with image from Ebert et al., 2014
eye decreased size, abnormal WT + MO1-plxna2 standard conditions Fig. 8 with image from Ebert et al., 2014
whole organism dcdc2b expression increased amount, abnormal WT + MO1-plxna2 standard conditions Fig. 4 with image from Emerson et al., 2017
optic vesicle shtn1 expression increased amount, abnormal WT + MO1-plxna2 + MO4-tp53 standard conditions Fig. 2 with image from Emerson et al., 2020
eye decreased size, abnormal zc7Tg + MO1-plxna2 standard conditions Fig. 7 from St Clair et al., 2017
optic vesicle GFP expression spatial pattern, abnormal zf460Tg + MO1-plxna2 standard conditions Fig. 2 with image from Emerson et al., 2020
optic vesicle cell mislocalised medially, abnormal zf460Tg + MO1-plxna2 standard conditions Fig. 2 with image from Ebert et al., 2014
optic vesicle formation decreased process quality, abnormal zf460Tg + MO1-plxna2 standard conditions Fig. 2 with image,  Fig. 3 with image,  Fig. 5 with image from Ebert et al., 2014
optic vesicle looseness, abnormal zf460Tg + MO1-plxna2 standard conditions Fig. 3 with image from Ebert et al., 2014
optic cup cell population proliferation decreased occurrence, abnormal zf460Tg + MO1-plxna2 standard conditions Fig. 1 with image from Emerson et al., 2017
eye decreased size, abnormal zf460Tg + MO1-plxna2 standard conditions Fig. 1 with image from Emerson et al., 2017
optic vesicle apoptotic process increased occurrence, abnormal zf460Tg + MO1-plxna2 standard conditions Fig. 4 with image,  Fig. 5 with image from Ebert et al., 2014
optic vesicle cell mislocalised, abnormal zf460Tg + MO1-plxna2 standard conditions Fig. 3 with image,  Fig. 4 with image,  Fig. 5 with image from Ebert et al., 2014
optic vesicle unstructured, abnormal zf460Tg + MO1-plxna2 standard conditions Fig. 4 with image from Ebert et al., 2014
optic vesicle decreased size, abnormal zf460Tg + MO1-plxna2 standard conditions Fig. 2 with image,  Fig. 5 with image from Ebert et al., 2014
optic vesicle edge shape, abnormal zf460Tg + MO1-plxna2 standard conditions Fig. 2 with image from Ebert et al., 2014
optic vesicle regionalization decreased process quality, abnormal WT + MO1-plxna2 + MO1-sema6a standard conditions Fig. 7 with image from Ebert et al., 2014
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.