Morpholino
MO2-tfap2c
- ID
- ZDB-MRPHLNO-080220-1
- Name
- MO2-tfap2c
- Previous Names
-
- tfap2c e3i3
- Target
- Sequence
-
5' - TCTGACATCAACTCACCTGAACATC - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
This is a splice blocking morpholino designed against the exon 3 splice donor site.
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-tfap2c
No data available
Phenotype
Phenotype resulting from MO2-tfap2c
No data available
Phenotype of all Fish created by or utilizing MO2-tfap2c
1 - 5 of 47 Show all
Citations
- Jandzik, D., Garnett, A.T., Square, T.A., Cattell, M.V., Yu, J.K., Medeiros, D.M. (2015) Evolution of the new vertebrate head by co-option of an ancient chordate skeletal tissue. Nature. 518:534-7
- Bhat, N., Kwon, H.J., and Riley, B.B. (2013) A gene network that coordinates preplacodal competence and neural crest specification in zebrafish. Developmental Biology. 373(1):107-117
- Powell, D.R., Hernandez-Lagunas, L., Lamonica, K., and Artinger, K.B. (2013) Prdm1a directly activates foxd3 and tfap2a during zebrafish neural crest specification. Development (Cambridge, England). 140(16):3445-3455
- Van Otterloo, E., Li, W., Garnett, A., Cattell, M., Medeiros, D.M., and Cornell, R.A. (2012) Novel Tfap2-mediated control of soxE expression facilitated the evolutionary emergence of the neural crest. Development (Cambridge, England). 139(4):720-730
- Kwon, H.J., Bhat, N., Sweet, E.M., Cornell, R.A., and Riley, B.B. (2010) Identification of early requirements for preplacodal ectoderm and sensory organ development. PLoS Genetics. 6(9):pii: e1001133
- Li, W., and Cornell, R.A. (2007) Redundant activities of Tfap2a and Tfap2c are required for neural crest induction and development of other non-neural ectoderm derivatives in zebrafish embryos. Developmental Biology. 304(1):338-354
1 - 6 of 6
Show