Morpholino
MO1-s1pr2
- ID
- ZDB-MRPHLNO-070911-3
- Name
- MO1-s1pr2
- Previous Names
-
- mil-MO (1)
- MO1-edg5
- Target
- Sequence
-
5' - CCGCAAACAGACGGCAAGTAGTCAT - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
- None
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-s1pr2
No data available
Phenotype
Phenotype resulting from MO1-s1pr2
1 - 5 of 47 Show all
Phenotype of all Fish created by or utilizing MO1-s1pr2
1 - 5 of 80 Show all
Citations
- Kidokoro, H., Saijoh, Y., Schoenwolf, G.C. (2022) Nodal signaling regulates asymmetric cellular behaviors, driving clockwise rotation of the heart tube in zebrafish. Communications biology. 5:996
- Wu, R.S., Lam, I.I., Clay, H., Duong, D.N., Deo, R.C., Coughlin, S.R. (2018) A Rapid Method for Directed Gene Knockout for Screening in G0 Zebrafish. Developmental Cell. 46:112-125.e4
- Bodrikov, V., Welte, C., Wiechers, M., Weschenfelder, M., Kaur, G., Shypitsyna, A., Pinzon-Olejua, A., Bastmeyer, M., Stuermer, C.A.O. (2017) Substrate properties of zebrafish Rtn4b/Nogo and axon regeneration in the zebrafish optic nerve. The Journal of comparative neurology. 525(14):2991-3009
- Xie, H., Ye, D., Sepich, D., Lin, F. (2016) S1pr2/Gα13 signaling regulates the migration of endocardial precursors by controlling endoderm convergence. Developmental Biology. 414:228-43
- Gu, Y., Shea, J., Slattum, G., Firpo, M.A., Alexander, M., Mulvihill, S.J., Golubovskaya, V.M., Rosenblatt, J. (2015) Defective apical extrusion signaling contributes to aggressive tumor hallmarks. eLIFE. 4:e04069
- Ye, D., Xie, H., Hu, B., Lin, F. (2015) Endoderm convergence controls subduction of the myocardial precursors during heart-tube formation. Development (Cambridge, England). 142:2928-40
- Fukui, H., Terai, K., Nakajima, H., Chiba, A., Fukuhara, S., Mochizuki, N. (2014) S1P-Yap1 Signaling Regulates Endoderm Formation Required for Cardiac Precursor Cell Migration in Zebrafish. Developmental Cell. 31:128-136
- Nakanaga, K., Hama, K., Kano, K., Sato, T., Yukiura, H., Inoue, A., Saigusa, D., Tokuyama, H., Tomioka, Y., Nishina, H., Kawahara, A., and Aoki, J. (2014) Overexpression of autotaxin, a lysophosphatidic acid-producing enzyme, enhances cardia bifida induced by hypo-sphingosine-1-phosphate signaling in zebrafish embryo. Journal of biochemistry. 155(4):235-41
- Hisano, Y., Ota, S., Arakawa, K., Muraki, M., Kono, N., Oshita, K., Sakuma, T., Tomita, M., Yamamoto, T., Okada, Y., and Kawahara, A. (2013) Quantitative assay for TALEN activity at endogenous genomic loci. Biology Open. 2(4):363-367
- Hisano, Y., Ota, S., Takada, S., and Kawahara, A. (2013) Functional cooperation of spns2 and fibronectin in cardiac and lower jaw development. Biology Open. 2(8):789-794
1 - 10 of 16
Show