Morpholino

MO2-ntn1a

ID
ZDB-MRPHLNO-060810-1
Name
MO2-ntn1a
Previous Names
  • ntn1a SBMO
Target
Sequence
5' - ATGATGGACTTACCGACACATTCGT - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-ntn1a
No data available
Phenotype
Phenotype resulting from MO2-ntn1a
Phenotype Fish Figures
angiogenesis disrupted, abnormal y1Tg + MO2-ntn1a Fig. 3 from Wilson et al., 2006
aortic arch absent, abnormal s843Tg + MO2-ntn1a Fig. 4 from Opitz et al., 2015
aortic arch hypoplastic, abnormal s843Tg + MO2-ntn1a Fig. 4 from Opitz et al., 2015
aortic arch morphology, abnormal s843Tg + MO2-ntn1a Fig. 4 from Opitz et al., 2015
heart jogging disrupted, abnormal WT + MO2-ntn1a Fig. 3 from Opitz et al., 2015
heart looping disrupted, abnormal WT + MO2-ntn1a Fig. 3 from Opitz et al., 2015
horizontal myoseptum lacks parts or has fewer parts of type motor neuron axon, abnormal ml2Tg + MO2-ntn1a Fig. 6 with image from Lim et al., 2011
horizontal myoseptum lacks parts or has fewer parts of type RoP motor neuron axon, abnormal ml2Tg + MO2-ntn1a Fig. 6 with image from Lim et al., 2011
hypobranchial artery dysplastic, abnormal s843Tg + MO2-ntn1a Fig. 4 from Opitz et al., 2015
hypobranchial artery morphology, abnormal s843Tg; ulb1Tg + MO2-ntn1a Fig. 4 from Opitz et al., 2015
lymph vessel development process quality, abnormal y1Tg/+ + MO2-ntn1a Fig. S1 with image from Lim et al., 2011
parachordal vessel incomplete structure, abnormal s843Tg + MO2-ntn1a Fig. S1 from Opitz et al., 2015
parachordal vessel morphology, abnormal s843Tg + MO2-ntn1a Fig. S1 from Opitz et al., 2015
pharyngeal vasculature morphology, abnormal s843Tg; ulb1Tg + MO2-ntn1a Fig. 4 from Opitz et al., 2015
thoracic duct aplastic, abnormal y1Tg/+ + MO2-ntn1a Fig. S1 with image from Lim et al., 2011
thyroid follicle mislocalised, abnormal s843Tg; ulb1Tg + MO2-ntn1a Fig. 4 from Opitz et al., 2015
thyroid follicle position, abnormal WT + MO2-ntn1a Fig. 3 from Opitz et al., 2015
thyroid follicle cell decreased amount, abnormal ulb1Tg + MO2-ntn1a Fig. 6 from Opitz et al., 2015
thyroid primordium distended, abnormal s843Tg; ulb1Tg + MO2-ntn1a Fig. 5 from Opitz et al., 2015
thyroid primordium mislocalised, abnormal s843Tg; ulb1Tg + MO2-ntn1a Fig. 4Fig. 5 from Opitz et al., 2015
thyroid primordium morphology, abnormal s843Tg; ulb1Tg + MO2-ntn1a Fig. 3Fig. 5 from Opitz et al., 2015
trunk vasculature lacks all parts of type parachordal vessel, abnormal y1Tg + MO2-ntn1a Fig. 3 from Wilson et al., 2006
VaP motor neuron axon increased branchiness, abnormal WT + MO2-ntn1a Fig. 2 with image from Hale et al., 2011
VaP motor neuron axon protruding into muscle pioneer, abnormal WT + MO2-ntn1a Fig. 2 with image from Hale et al., 2011
ventral aorta morphology, abnormal s843Tg + MO2-ntn1a Fig. 4 from Opitz et al., 2015
ventral aorta separated from bulbus arteriosus, abnormal s843Tg + MO2-ntn1a Fig. 4 from Opitz et al., 2015
Phenotype of all Fish created by or utilizing MO2-ntn1a
Phenotype Fish Conditions Figures
heart jogging disrupted, abnormal WT + MO2-ntn1a standard conditions Fig. 3 from Opitz et al., 2015
heart looping disrupted, abnormal WT + MO2-ntn1a standard conditions Fig. 3 from Opitz et al., 2015
VaP motor neuron axon protruding into muscle pioneer, abnormal WT + MO2-ntn1a standard conditions Fig. 2 with image from Hale et al., 2011
VaP motor neuron axon increased branchiness, abnormal WT + MO2-ntn1a standard conditions Fig. 2 with image from Hale et al., 2011
thyroid follicle position, abnormal WT + MO2-ntn1a standard conditions Fig. 3 from Opitz et al., 2015
thyroid primordium morphology, abnormal WT + MO2-ntn1a standard conditions Fig. 3 from Opitz et al., 2015
lymph vessel development process quality, abnormal y1Tg/+ + MO2-ntn1a standard conditions Fig. S1 with image from Lim et al., 2011
thoracic duct aplastic, abnormal y1Tg/+ + MO2-ntn1a standard conditions Fig. S1 with image from Lim et al., 2011
horizontal myoseptum lacks parts or has fewer parts of type RoP motor neuron axon, abnormal ml2Tg + MO2-ntn1a standard conditions Fig. 6 with image from Lim et al., 2011
horizontal myoseptum lacks parts or has fewer parts of type motor neuron axon, abnormal ml2Tg + MO2-ntn1a standard conditions Fig. 6 with image from Lim et al., 2011
ventral aorta separated from bulbus arteriosus, abnormal s843Tg + MO2-ntn1a standard conditions Fig. 4 from Opitz et al., 2015
parachordal vessel incomplete structure, abnormal s843Tg + MO2-ntn1a standard conditions Fig. S1 from Opitz et al., 2015
hypobranchial artery dysplastic, abnormal s843Tg + MO2-ntn1a standard conditions Fig. 4 from Opitz et al., 2015
ventral aorta morphology, abnormal s843Tg + MO2-ntn1a standard conditions Fig. 4 from Opitz et al., 2015
parachordal vessel morphology, abnormal s843Tg + MO2-ntn1a standard conditions Fig. S1 from Opitz et al., 2015
pharyngeal vasculature morphology, abnormal s843Tg + MO2-ntn1a standard conditions Fig. 4 from Opitz et al., 2015
aortic arch hypoplastic, abnormal s843Tg + MO2-ntn1a standard conditions Fig. 4 from Opitz et al., 2015
aortic arch absent, abnormal s843Tg + MO2-ntn1a standard conditions Fig. 4 from Opitz et al., 2015
aortic arch morphology, abnormal s843Tg + MO2-ntn1a standard conditions Fig. 4 from Opitz et al., 2015
thyroid follicle cell decreased amount, abnormal ulb1Tg + MO2-ntn1a standard conditions Fig. 6 from Opitz et al., 2015
angiogenesis disrupted, abnormal y1Tg + MO2-ntn1a standard conditions Fig. 3 from Wilson et al., 2006
trunk vasculature lacks all parts of type parachordal vessel, abnormal y1Tg + MO2-ntn1a standard conditions Fig. 3 from Wilson et al., 2006
thyroid primordium mislocalised, abnormal s843Tg; ulb1Tg + MO2-ntn1a standard conditions Fig. 4Fig. 5 from Opitz et al., 2015
thyroid primordium morphology, abnormal s843Tg; ulb1Tg + MO2-ntn1a standard conditions Fig. 5 from Opitz et al., 2015
pharyngeal vasculature morphology, abnormal s843Tg; ulb1Tg + MO2-ntn1a standard conditions Fig. 4 from Opitz et al., 2015
thyroid primordium distended, abnormal s843Tg; ulb1Tg + MO2-ntn1a standard conditions Fig. 5 from Opitz et al., 2015
hypobranchial artery morphology, abnormal s843Tg; ulb1Tg + MO2-ntn1a standard conditions Fig. 4 from Opitz et al., 2015
thyroid follicle mislocalised, abnormal s843Tg; ulb1Tg + MO2-ntn1a standard conditions Fig. 4 from Opitz et al., 2015
VaP motor neuron axon protruding into horizontal myoseptum, abnormal ml2Tg + MO1-ntn2 + MO2-ntn1a standard conditions Fig. 9 with image from Hale et al., 2011
VaP motor neuron axon protruding into horizontal myoseptum, abnormal ml2Tg + MO2-ntn1a + MO3-ntn1b standard conditions Fig. 9 with image from Hale et al., 2011
dendrite development disrupted, abnormal rw0Tg + MO1-ntn1b + MO2-ntn1a standard conditions Fig. 4 from Suli et al., 2006
efferent neuron dendrite mislocalised, abnormal rw0Tg + MO1-ntn1b + MO2-ntn1a standard conditions Fig. 4 from Suli et al., 2006
efferent neuron dendrite decreased amount, abnormal rw0Tg + MO1-ntn1b + MO2-ntn1a standard conditions Fig. 4 from Suli et al., 2006
olfactory receptor cell axon attached to anteromedial zone olfactory bulb, abnormal p201Tg; p202Tg + MO2-ntn1a standard conditions Fig. 8 from Lakhina et al., 2012
olfactory receptor cell axon attached to ventral zone olfactory bulb, abnormal p201Tg; p202Tg + MO2-ntn1a standard conditions Fig. 8 from Lakhina et al., 2012
olfactory bulb axon guidance disrupted, abnormal p201Tg; p202Tg + MO2-ntn1a standard conditions Fig. 5Fig. 8 from Lakhina et al., 2012
olfactory receptor cell axon position, abnormal p201Tg; p202Tg + MO2-ntn1a standard conditions Fig. 5Fig. 8 from Lakhina et al., 2012
olfactory receptor cell axon posterior to olfactory bulb, abnormal p201Tg; p202Tg + MO2-ntn1a standard conditions Fig. 8 from Lakhina et al., 2012
branching involved in lymph vessel morphogenesis process quality, abnormal plcg1y10/+; y1Tg/+ + MO2-ntn1a standard conditions Fig. 1 with image from Lim et al., 2011
parachordal vessel immature, abnormal plcg1y10/+; y1Tg/+ + MO2-ntn1a standard conditions Fig. 1 with image from Lim et al., 2011
parachordal vessel venous endothelial cell migration involved in lymph vessel development arrested, abnormal plcg1y10/+; y1Tg/+ + MO2-ntn1a standard conditions Fig. 1 with image from Lim et al., 2011
olfactory bulb axon guidance disrupted, abnormal p201Tg; p202Tg + MO1-ntn1b + MO2-ntn1a standard conditions Fig. 5Fig. 8 from Lakhina et al., 2012
olfactory receptor cell axon attached to medial protoglomerulus, abnormal p201Tg; p202Tg + MO1-ntn1b + MO2-ntn1a standard conditions Fig. 5 from Lakhina et al., 2012
olfactory receptor cell axon position, abnormal p201Tg; p202Tg + MO1-ntn1b + MO2-ntn1a standard conditions Fig. 5Fig. 8 from Lakhina et al., 2012
olfactory receptor cell axon attached to dorsal zone olfactory bulb, abnormal p201Tg; p202Tg + MO1-ntn1b + MO2-ntn1a standard conditions Fig. 5 from Lakhina et al., 2012
olfactory receptor cell axon posterior to olfactory bulb, abnormal p201Tg; p202Tg + MO1-ntn1b + MO2-ntn1a standard conditions Fig. 8 from Lakhina et al., 2012
olfactory receptor cell axon attached to anteromedial zone olfactory bulb, abnormal p201Tg; p202Tg + MO1-ntn1b + MO2-ntn1a standard conditions Fig. 8 from Lakhina et al., 2012
olfactory receptor cell axon attached to ventral zone olfactory bulb, abnormal p201Tg; p202Tg + MO1-ntn1b + MO2-ntn1a standard conditions Fig. 8 from Lakhina et al., 2012
Citations