Morpholino
MO1-dnd1
- ID
- ZDB-MRPHLNO-050413-1
- Name
- MO1-dnd1
- Previous Names
- Target
- Sequence
-
5' - GCTGGGCATCCATGTCTCCGACCAT - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
- None
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-dnd1
No data available
Phenotype
Phenotype resulting from MO1-dnd1
1 - 5 of 47 Show all
Phenotype of all Fish created by or utilizing MO1-dnd1
1 - 5 of 74 Show all
Citations
- Wang, X., Zhu, J., Wang, H., Deng, W., Jiao, S., Wang, Y., He, M., Zhang, F., Liu, T., Hao, Y., Ye, D., Sun, Y. (2023) Induced formation of primordial germ cells from zebrafish blastomeres by germplasm factors. Nature communications. 14:79187918
- Westerich, K.J., Reinecke, S., Emich, J., Wyrwoll, M.J., Stallmeyer, B., Meyer, M., Oud, M.S., Fietz, D., Pilatz, A., Kliesch, S., Reichman-Fried, M., Tarbashevich, K., Limon, T., Stehling, M., Friedrich, C., Tüttelmann, F., Raz, E. (2023) Linking human Dead end 1 (DND1) variants to male infertility employing zebrafish embryos. Human reproduction (Oxford, England). 38(4):655-670
- Sun, X., Tao, B., Wang, Y., Hu, W., Sun, Y. (2022) Isolation and Characterization of Germline Stem Cells in Protogynous Hermaphroditic Monopterus albus. International Journal of Molecular Sciences. 23(11)
- Zhang, R., Tu, Y.X., Ye, D., Gu, Z., Chen, Z.X., Sun, Y. (2022) A Germline-Specific Regulator of Mitochondrial Fusion is Required for Maintenance and Differentiation of Germline Stem and Progenitor Cells. Advanced science (Weinheim, Baden-Wurttemberg, Germany). 9(36):e2203631
- Wang, Y., Ye, D., Zhang, F., Zhang, R., Zhu, J., Wang, H., He, M., Sun, Y. (2021) Cyp11a2 is essential for oocyte development and spermatogonial stem cell differentiation in zebrafish. Endocrinology. 163(2):
- Chen, H.Y., Jolly, C., Bublys, K., Marcu, D., Immler, S. (2020) Trade-off between somatic and germline repair in a vertebrate supports the expensive germ line hypothesis. Proceedings of the National Academy of Sciences of the United States of America. 117(16):8973-8979
- Zhang, F., Li, X., He, M., Ye, D., Xiong, F., Amin, G., Zhu, Z., Sun, Y. (2020) Efficient generation of zebrafish maternal-zygotic mutants through transplantation of ectopically induced and Cas9/gRNA targeted primordial germ cells. Journal of genetics and genomics = Yi chuan xue bao. 47(1):37-47
- Marinović, Z., Li, Q., Lujić, J., Iwasaki, Y., Csenki, Z., Urbányi, B., Yoshizaki, G., Horváth, Á. (2019) Preservation of zebrafish genetic resources through testis cryopreservation and spermatogonia transplantation. Scientific Reports. 9:13861
- Sanchez, A., Xu, L., Pierce, J.L., Lafin, J.T., Abe, D., Bagrodia, A., Frazier, A.L., Amatruda, J.F. (2019) Identification of testicular cancer driver genes by a cross-species comparative oncology approach. Andrology. 7(4):545-554
- Pfeiffer, J., Tarbashevich, K., Bandemer, J., Palm, T., Raz, E. (2018) Rapid progression through the cell cycle ensures efficient migration of primordial germ cells - the role of Hsp90. Developmental Biology. 436(2):84-93
1 - 10 of 47
Show