ZFIN ID: ZDB-GENE-980526-69

Mapping Details

Gene Name: even-skipped-like1
Symbol: eve1
PHYSICAL MAP AND BROWSER
Genome Browser Chr Position Assembly
ZFIN JBrowse 3 22,381,779 - 22,383,652 GRCz12tu
NCBI Map Viewer 3 22,381,779 - 22,383,652 GRCz12tu
Ensembl 3 23,641,935 - 23,643,830 GRCz11
NCBI Map Viewer 3 23,641,935 - 23,643,808 GRCz11
UCSC 3 - GRCz11
Vega 3 23,511,387 - 23,513,282 GRCv10
Mapped Clones containing eve1
CH211-72A16 Chr: 3 Details
PHYSICAL MAPPING No data available

GENETIC MAPPING PANELS
Chr Location Mapped As Panel Mapped By Scoring
3 46.0 cM eve1 Mother of Pearl (MOP) Postlethwait, John H. Data
3 162.38 cR eve1 Loeb/NIH/5000/4000 (LN54) Dawid, Igor B. Data
3 44.1 cM eve1 Heat Shock (HS) Woods, Ian G. Data
3 54.66 cM eve1 Gates et al (GAT) Talbot, William S. Data
Note: Physical map location as displayed in the genome browsers is more precise than linkage map location.
Physical map location should be used whenever possible.
MAPPING FROM PUBLICATIONS
Marker Type Chr Distance Publication / Person Comments
hoxb5a GENE 3 Amores et al., 1998 Using overlapping PAC clones, Amores, et al. (1998. Science 282:1711-1714.) report eve1, hoxb10a, hoxb9a, hoxb8a, hoxb7a, hoxb6a, hoxb5a, hoxb4a, hoxb3a, hoxb2a, and hoxb1a are clustered on a continuous region of the genome. Subsequent mapping of one or more of these genes localize all to LG03.
hoxb1a GENE 3 Amores et al., 1998 Using overlapping PAC clones, Amores, et al. (1998. Science 282:1711-1714.) report eve1, hoxb10a, hoxb9a, hoxb8a, hoxb7a, hoxb6a, hoxb5a, hoxb4a, hoxb3a, hoxb2a, and hoxb1a are clustered on a continuous region of the genome. Subsequent mapping of one or more of these genes localize all to LG03.
hoxb2a GENE 3 Amores et al., 1998 Using overlapping PAC clones, Amores, et al. (1998. Science 282:1711-1714.) report eve1, hoxb10a, hoxb9a, hoxb8a, hoxb7a, hoxb6a, hoxb5a, hoxb4a, hoxb3a, hoxb2a, and hoxb1a are clustered on a continuous region of the genome. Subsequent mapping of one or more of these genes localize all to LG03.
hoxb3a GENE 3 Amores et al., 1998 Using overlapping PAC clones, Amores, et al. (1998. Science 282:1711-1714.) report eve1, hoxb10a, hoxb9a, hoxb8a, hoxb7a, hoxb6a, hoxb5a, hoxb4a, hoxb3a, hoxb2a, and hoxb1a are clustered on a continuous region of the genome. Subsequent mapping of one or more of these genes localize all to LG03.
hoxb4a GENE 3 Amores et al., 1998 Using overlapping PAC clones, Amores, et al. (1998. Science 282:1711-1714.) report eve1, hoxb10a, hoxb9a, hoxb8a, hoxb7a, hoxb6a, hoxb5a, hoxb4a, hoxb3a, hoxb2a, and hoxb1a are clustered on a continuous region of the genome. Subsequent mapping of one or more of these genes localize all to LG03.
hoxb6a GENE 3 Amores et al., 1998 Using overlapping PAC clones, Amores, et al. (1998. Science 282:1711-1714.) report eve1, hoxb10a, hoxb9a, hoxb8a, hoxb7a, hoxb6a, hoxb5a, hoxb4a, hoxb3a, hoxb2a, and hoxb1a are clustered on a continuous region of the genome. Subsequent mapping of one or more of these genes localize all to LG03.
hoxb8a GENE 3 Amores et al., 1998 Using overlapping PAC clones, Amores, et al. (1998. Science 282:1711-1714.) report eve1, hoxb10a, hoxb9a, hoxb8a, hoxb7a, hoxb6a, hoxb5a, hoxb4a, hoxb3a, hoxb2a, and hoxb1a are clustered on a continuous region of the genome. Subsequent mapping of one or more of these genes localize all to LG03.
hoxb9a GENE 3 Amores et al., 1998 Using overlapping PAC clones, Amores, et al. (1998. Science 282:1711-1714.) report eve1, hoxb10a, hoxb9a, hoxb8a, hoxb7a, hoxb6a, hoxb5a, hoxb4a, hoxb3a, hoxb2a, and hoxb1a are clustered on a continuous region of the genome. Subsequent mapping of one or more of these genes localize all to LG03.
hoxb7a GENE 3 Amores et al., 1998 Using overlapping PAC clones, Amores, et al. (1998. Science 282:1711-1714.) report eve1, hoxb10a, hoxb9a, hoxb8a, hoxb7a, hoxb6a, hoxb5a, hoxb4a, hoxb3a, hoxb2a, and hoxb1a are clustered on a continuous region of the genome. Subsequent mapping of one or more of these genes localize all to LG03.
hoxb10a GENE 3 Amores et al., 1998 Using overlapping PAC clones, Amores, et al. (1998. Science 282:1711-1714.) report eve1, hoxb10a, hoxb9a, hoxb8a, hoxb7a, hoxb6a, hoxb5a, hoxb4a, hoxb3a, hoxb2a, and hoxb1a are clustered on a continuous region of the genome. Subsequent mapping of one or more of these genes localize all to LG03.

OTHER MAPPING INFORMATION
Chr 3 Amores et al., 1998 Using overlapping PAC clones, Amores, et al. (1998. Science 282:1711-1714.) report eve1,  ...
Primer Sets:
Strain Bandsize Restriction Enzyme Annealing Temperature [C]
SJD 580 Sau96I 36.0
Forward Primer CTACTGAATGGTATCGACCAAA
Reverse Primer ACGTTGTCTCTTGTCCTTCATT