ZFIN ID: ZDB-GENE-980526-168

Mapping Details

Gene Name:	cyclin E1
Symbol:	ccne1

PHYSICAL MAP AND BROWSER

Genome Browser	Chr	Position	Assembly
ZFIN JBrowse	7	46,019,780 - 46,029,879	GRCz11
Ensembl	7	46,019,780 - 46,029,879	GRCz11
Vega	7	45,747,414 - 45,757,513	GRCv10
NCBI Map Viewer	7	46,020,070 - 46,029,879	GRCz11
UCSC	7	-	GRCv10

Mapped Clones containing ccne1
DKEY-56M16	Chr: 7 Details
CH211-260E23	Chr: 7 Details

PHYSICAL MAPPING

Feature	Chr	Position	Assembly	Citations
sa8454	7	46,025,940	GRCz11	Busch-Nentwich et al., 2013
	7	45,753,574	GRCz10	Busch-Nentwich et al., 2013
	7	47,635,463	Zv9	Busch-Nentwich et al., 2013
sa17090	7	46,025,497	GRCz11	Busch-Nentwich et al., 2013
	7	45,753,131	GRCz10	Busch-Nentwich et al., 2013
	7	47,635,020	Zv9	Busch-Nentwich et al., 2013
sa25369	7	46,025,786	GRCz11	Busch-Nentwich et al., 2013
	7	45,753,420	GRCz10	Busch-Nentwich et al., 2013
	7	47,635,309	Zv9	Busch-Nentwich et al., 2013

GENETIC MAPPING PANELS
Chr	Location	Mapped As	Panel	Mapped By	Scoring
7	111.6 cM	cyce	Mother of Pearl (MOP)	Postlethwait, John H.	Data
7	176.01 cR	cyce	Loeb/NIH/5000/4000 (LN54)	Dawid, Igor B.	Data
7	94.5 cM	ccne	Heat Shock (HS)	Woods, Ian G.	Data
7	75.84 cM	cyce	Gates et al (GAT)	Talbot, William S.	Data

Note: Physical map location as displayed in the genome browsers is more precise than linkage map location. Note: Physical map location should be used whenever possible.

MAPPING FROM PUBLICATIONS
Marker	Type	Chr	Distance	Publication / Person	Comments
z1182	SSLP	7	7.5 cM	Bertrand et al., 2001	Bertrand, C. et al. (2001, J. Biol. Chem. 276(1):464-474) mapped ache to LG7 on the MOP panel.
isl2b	GENE	7		Bertrand et al., 2001	Bertrand, C. et al. (2001, J. Biol. Chem. 276(1):464-474) mapped ache to LG7 on the MOP panel.
foxb1b	GENE	7		Bertrand et al., 2001	Bertrand, C. et al. (2001, J. Biol. Chem. 276(1):464-474) mapped ache to LG7 on the MOP panel.
z1059	SSLP	7		Bertrand et al., 2001	Bertrand, C. et al. (2001, J. Biol. Chem. 276(1):464-474) mapped ache to LG7 on the MOP panel.
z3445	SSLP	7		Bertrand et al., 2001	Bertrand, C. et al. (2001, J. Biol. Chem. 276(1):464-474) mapped ache to LG7 on the MOP panel.
z4706	SSLP	7		Bertrand et al., 2001	Bertrand, C. et al. (2001, J. Biol. Chem. 276(1):464-474) mapped ache to LG7 on the MOP panel.
ache	GENE	7		Bertrand et al., 2001	Bertrand, C. et al. (2001, J. Biol. Chem. 276(1):464-474) mapped ache to LG7 on the MOP panel.
en2a	GENE	7		Bertrand et al., 2001	Bertrand, C. et al. (2001, J. Biol. Chem. 276(1):464-474) mapped ache to LG7 on the MOP panel.
shha	GENE	7		Bertrand et al., 2001	Bertrand, C. et al. (2001, J. Biol. Chem. 276(1):464-474) mapped ache to LG7 on the MOP panel.

Markers Encoded by ccne1
fa18e07 Chr: 7 Details

Primer Sets:
Strain	Bandsize	Restriction Enzyme	Annealing Temperature [C]
SJD	563	Tsp509I	36.0
Forward Primer	AGAGAGCACCATCTCTTGACTT
Reverse Primer	CAAACACTCAGAAGTTGACCAG