ZFIN ID: ZDB-GENE-980526-168

Mapping Details

Gene Name: cyclin E1
Symbol: ccne1
PHYSICAL MAP AND BROWSER
Genome Browser Chr Position Assembly
Vega 7 45,747,414 - 45,757,513 GRCv10
NCBI Map Viewer 7 46,020,070 - 46,029,879 GRCz11
Mapped Clones containing ccne1
DKEY-56M16 Chr: 7 Details
CH211-260E23 Chr: 7 Details
PHYSICAL MAPPING
Feature Chr Position Assembly Citations
sa8454 7 46,025,940 GRCz11 Busch-Nentwich et al., 2013
7 45,753,574 GRCz10 Busch-Nentwich et al., 2013
7 47,635,463 Zv9 Busch-Nentwich et al., 2013
sa17090 7 46,025,497 GRCz11 Busch-Nentwich et al., 2013
7 45,753,131 GRCz10 Busch-Nentwich et al., 2013
7 47,635,020 Zv9 Busch-Nentwich et al., 2013
sa25369 7 46,025,786 GRCz11 Busch-Nentwich et al., 2013
7 45,753,420 GRCz10 Busch-Nentwich et al., 2013
7 47,635,309 Zv9 Busch-Nentwich et al., 2013
ihb541 7 GRCz11
7 GRCz11
7 GRCz11
7 GRCz11
ihb542 7 GRCz11
7 GRCz11
7 GRCz11
7 GRCz11
sa8454 7 GRCz11
7 GRCz11
7 GRCz11
7 GRCz11
sa17090 7 GRCz11
7 GRCz11
7 GRCz11
7 GRCz11
sa25369 7 GRCz11
7 GRCz11
7 GRCz11
7 GRCz11

GENETIC MAPPING PANELS
Chr Location Mapped As Panel Mapped By Scoring
7 111.6 cM cyce Mother of Pearl (MOP) Postlethwait, John H. Data
7 176.01 cR cyce Loeb/NIH/5000/4000 (LN54) Dawid, Igor B. Data
7 94.5 cM ccne Heat Shock (HS) Woods, Ian G. Data
7 75.84 cM cyce Gates et al (GAT) Talbot, William S. Data
Note: Physical map location as displayed in the genome browsers is more precise than linkage map location.
Physical map location should be used whenever possible.
MAPPING FROM PUBLICATIONS
Marker Type Chr Distance Publication / Person Comments
z1182 SSLP 7 7.5 cM Bertrand et al., 2001 Bertrand, C. et al. (2001, J. Biol. Chem. 276(1):464-474) mapped ache to LG7 on the MOP panel.
isl2b GENE 7 Bertrand et al., 2001 Bertrand, C. et al. (2001, J. Biol. Chem. 276(1):464-474) mapped ache to LG7 on the MOP panel.
foxb1b GENE 7 Bertrand et al., 2001 Bertrand, C. et al. (2001, J. Biol. Chem. 276(1):464-474) mapped ache to LG7 on the MOP panel.
z1059 SSLP 7 Bertrand et al., 2001 Bertrand, C. et al. (2001, J. Biol. Chem. 276(1):464-474) mapped ache to LG7 on the MOP panel.
z3445 SSLP 7 Bertrand et al., 2001 Bertrand, C. et al. (2001, J. Biol. Chem. 276(1):464-474) mapped ache to LG7 on the MOP panel.
z4706 SSLP 7 Bertrand et al., 2001 Bertrand, C. et al. (2001, J. Biol. Chem. 276(1):464-474) mapped ache to LG7 on the MOP panel.
ache GENE 7 Bertrand et al., 2001 Bertrand, C. et al. (2001, J. Biol. Chem. 276(1):464-474) mapped ache to LG7 on the MOP panel.
en2a GENE 7 Bertrand et al., 2001 Bertrand, C. et al. (2001, J. Biol. Chem. 276(1):464-474) mapped ache to LG7 on the MOP panel.
shha GENE 7 Bertrand et al., 2001 Bertrand, C. et al. (2001, J. Biol. Chem. 276(1):464-474) mapped ache to LG7 on the MOP panel.

OTHER MAPPING INFORMATION
Markers Encoded by ccne1
fa18e07 Chr: 7 Details
Primer Sets:
Strain Bandsize Restriction Enzyme Annealing Temperature [C]
SJD 563 Tsp509I 36.0
Forward Primer AGAGAGCACCATCTCTTGACTT
Reverse Primer CAAACACTCAGAAGTTGACCAG