ZFIN ID: ZDB-GENE-980526-70

Mapping Details

Gene Name: homeobox B5a
Symbol: hoxb5a
PHYSICAL MAP AND BROWSER
Genome Browser Chr Position Assembly
Vega 3 23,577,143 - 23,579,547 GRCv10
NCBI Map Viewer 3 23,707,700 - 23,710,095 GRCz11
Mapped Clones containing hoxb5a
CH211-72A16 Chr: 3 Details
BUSM1-254O17 Chr: 3 Details
PHYSICAL MAPPING
Feature Chr Position Assembly Citations
sud125 3 23,708,312 - 23,708,318 GRCz11 Maeno et al., 2024
fh468Tg 3 GRCz11
3 GRCz11
3 GRCz11
3 GRCz11
fh477 3 GRCz11
3 GRCz11
3 GRCz11
3 GRCz11
sud125 3 GRCz11
3 GRCz11
3 GRCz11
3 GRCz11

GENETIC MAPPING PANELS
Chr Location Mapped As Panel Mapped By Scoring
3 46.0 cM hoxb5a Mother of Pearl (MOP) Postlethwait, John H. Data
3 181.91 cR ZF21 Loeb/NIH/5000/4000 (LN54) Dawid, Igor B. Data
Note: Physical map location as displayed in the genome browsers is more precise than linkage map location.
Physical map location should be used whenever possible.
MAPPING FROM PUBLICATIONS
Marker Type Chr Distance Publication / Person Comments
hoxb7a GENE 3 Amores et al., 1998 Using overlapping PAC clones, Amores, et al. (1998. Science 282:1711-1714.) report eve1, hoxb10a, hoxb9a, hoxb8a, hoxb7a, hoxb6a, hoxb5a, hoxb4a, hoxb3a, hoxb2a, and hoxb1a are clustered on a continuous region of the genome. Subsequent mapping of one or more of these genes localize all to LG03.
hoxb2a GENE 3 Amores et al., 1998 Using overlapping PAC clones, Amores, et al. (1998. Science 282:1711-1714.) report eve1, hoxb10a, hoxb9a, hoxb8a, hoxb7a, hoxb6a, hoxb5a, hoxb4a, hoxb3a, hoxb2a, and hoxb1a are clustered on a continuous region of the genome. Subsequent mapping of one or more of these genes localize all to LG03.
hoxb3a GENE 3 Amores et al., 1998 Using overlapping PAC clones, Amores, et al. (1998. Science 282:1711-1714.) report eve1, hoxb10a, hoxb9a, hoxb8a, hoxb7a, hoxb6a, hoxb5a, hoxb4a, hoxb3a, hoxb2a, and hoxb1a are clustered on a continuous region of the genome. Subsequent mapping of one or more of these genes localize all to LG03.
hoxb4a GENE 3 Amores et al., 1998 Using overlapping PAC clones, Amores, et al. (1998. Science 282:1711-1714.) report eve1, hoxb10a, hoxb9a, hoxb8a, hoxb7a, hoxb6a, hoxb5a, hoxb4a, hoxb3a, hoxb2a, and hoxb1a are clustered on a continuous region of the genome. Subsequent mapping of one or more of these genes localize all to LG03.
hoxb6a GENE 3 Amores et al., 1998 Using overlapping PAC clones, Amores, et al. (1998. Science 282:1711-1714.) report eve1, hoxb10a, hoxb9a, hoxb8a, hoxb7a, hoxb6a, hoxb5a, hoxb4a, hoxb3a, hoxb2a, and hoxb1a are clustered on a continuous region of the genome. Subsequent mapping of one or more of these genes localize all to LG03.
hoxb8a GENE 3 Amores et al., 1998 Using overlapping PAC clones, Amores, et al. (1998. Science 282:1711-1714.) report eve1, hoxb10a, hoxb9a, hoxb8a, hoxb7a, hoxb6a, hoxb5a, hoxb4a, hoxb3a, hoxb2a, and hoxb1a are clustered on a continuous region of the genome. Subsequent mapping of one or more of these genes localize all to LG03.
hoxb9a GENE 3 Amores et al., 1998 Using overlapping PAC clones, Amores, et al. (1998. Science 282:1711-1714.) report eve1, hoxb10a, hoxb9a, hoxb8a, hoxb7a, hoxb6a, hoxb5a, hoxb4a, hoxb3a, hoxb2a, and hoxb1a are clustered on a continuous region of the genome. Subsequent mapping of one or more of these genes localize all to LG03.
eve1 GENE 3 Amores et al., 1998 Using overlapping PAC clones, Amores, et al. (1998. Science 282:1711-1714.) report eve1, hoxb10a, hoxb9a, hoxb8a, hoxb7a, hoxb6a, hoxb5a, hoxb4a, hoxb3a, hoxb2a, and hoxb1a are clustered on a continuous region of the genome. Subsequent mapping of one or more of these genes localize all to LG03.
hoxb1a GENE 3 Amores et al., 1998 Using overlapping PAC clones, Amores, et al. (1998. Science 282:1711-1714.) report eve1, hoxb10a, hoxb9a, hoxb8a, hoxb7a, hoxb6a, hoxb5a, hoxb4a, hoxb3a, hoxb2a, and hoxb1a are clustered on a continuous region of the genome. Subsequent mapping of one or more of these genes localize all to LG03.
hoxb10a GENE 3 Amores et al., 1998 Using overlapping PAC clones, Amores, et al. (1998. Science 282:1711-1714.) report eve1, hoxb10a, hoxb9a, hoxb8a, hoxb7a, hoxb6a, hoxb5a, hoxb4a, hoxb3a, hoxb2a, and hoxb1a are clustered on a continuous region of the genome. Subsequent mapping of one or more of these genes localize all to LG03.
hoxb4a GENE 3 Woltering et al., 2006 Woltering and Durston (2006, Nat. Genet. 38(6):601-602) have mapped mirn10c between hoxb4a and hoxb5a.
mir10c MIRNAG 3 Woltering et al., 2006 Woltering and Durston (2006, Nat. Genet. 38(6):601-602) have mapped mirn10c between hoxb4a and hoxb5a.

OTHER MAPPING INFORMATION
Chr 3 Amores et al., 1998 Using overlapping PAC clones, Amores, et al. (1998. Science 282:1711-1714.) report eve1,  ...
Chr 3 Woltering et al., 2006 Woltering and Durston (2006, Nat. Genet. 38(6):601-602) have mapped mirn10c between  ...
Markers Encoded by hoxb5a
fc38c09 Chr: 3 Details
Primer Sets:
Strain Bandsize Restriction Enzyme Annealing Temperature [C]
SJD 1736 DraI 36.0
Forward Primer ACACGTACACGTTTCAGTCACA
Reverse Primer ACAGGTCAGCTTTCTCTTTTGG
Genomic Feature sud125 is an allele of hoxb5a