ZFIN ID: ZDB-GENE-980526-389

Mapping Details

Gene Name: growth differentiation factor 3
Symbol: gdf3
PHYSICAL MAP AND BROWSER
Genome Browser Chr Position Assembly
ZFIN 17 5,350,590 - 5,363,462 GRCz12tu
NCBI Map Viewer 17 5,350,590 - 5,363,462 GRCz12tu
Ensembl 17 4,239,437 - 4,252,221 GRCz11
NCBI Map Viewer 17 4,239,433 - 4,252,228 GRCz11
UCSC 17 - GRCz11
Vega 17 4,081,036 - 4,093,820 GRCv10
Mapped Clones containing gdf3
ZFOS-1139C7 Chr: 17 Details
PHYSICAL MAPPING
Feature Chr Position Assembly Source DetailedSource Citations
fb20a 17 4,240,106 - 4,240,115 GRCz11 DIRECT Guner-Ataman et al., 2018
pr05 17 4,245,057 - 4,245,076 GRCz11 DIRECT Pelliccia et al., 2017
pr06 17 4,245,057 - 4,245,273 GRCz11 DIRECT Pelliccia et al., 2017
pr11 17 4,245,057 - 4,245,058 GRCz11 DIRECT Pelliccia et al., 2017
sa22982 17 5,356,346 GRCz12tu DIRECT Sealy et al., 2025
17 4,245,179 GRCz11 DIRECT Busch-Nentwich et al., 2013
17 4,086,778 GRCz10 DIRECT Busch-Nentwich et al., 2013
17 4,022,555 Zv9 DIRECT Busch-Nentwich et al., 2013
zy51 17 4,245,239 - 4,245,246 GRCz11 DIRECT Bisgrove et al., 2017
zy52 17 4,245,241 GRCz11 DIRECT Bisgrove et al., 2017
zy53 17 4,245,239 - 4,245,244 GRCz11 DIRECT Bisgrove et al., 2017
a164 17 GRCz11 OTHER_MAPPING Feature location obtained from related gene that has mapped_marker info
17 GRCz11 OTHER_MAPPING featureLocationPullThruFromGenePaneledMarkers
17 GRCz11 OTHER_MAPPING featureLocationPullThruFromGeneGBrowse
a165 17 GRCz11 OTHER_MAPPING featureLocationPullThruFromGeneGBrowse
17 GRCz11 OTHER_MAPPING featureLocationPullThruFromGenePaneledMarkers
17 GRCz11 OTHER_MAPPING Feature location obtained from related gene that has mapped_marker info
fb20a 17 GRCz11 OTHER_MAPPING Feature location obtained from related gene that has mapped_marker info
17 GRCz11 OTHER_MAPPING featureLocationPullThruFromGenePaneledMarkers
17 GRCz11 OTHER_MAPPING featureLocationPullThruFromGeneGBrowse
pr05 17 GRCz11 OTHER_MAPPING featureLocationPullThruFromGeneGBrowse
17 GRCz11 OTHER_MAPPING Feature location obtained from related gene that has mapped_marker info
17 GRCz11 OTHER_MAPPING featureLocationPullThruFromGenePaneledMarkers
pr06 17 GRCz11 OTHER_MAPPING featureLocationPullThruFromGeneGBrowse
17 GRCz11 OTHER_MAPPING featureLocationPullThruFromGenePaneledMarkers
17 GRCz11 OTHER_MAPPING Feature location obtained from related gene that has mapped_marker info
pr11 17 GRCz11 OTHER_MAPPING Feature location obtained from related gene that has mapped_marker info
17 GRCz11 OTHER_MAPPING featureLocationPullThruFromGeneGBrowse
17 GRCz11 OTHER_MAPPING featureLocationPullThruFromGenePaneledMarkers
sa22982 17 GRCz11 OTHER_MAPPING featureLocationPullThruFromGenePaneledMarkers
17 GRCz11 OTHER_MAPPING Feature location obtained from related gene that has mapped_marker info
17 GRCz11 OTHER_MAPPING featureLocationPullThruFromGeneGBrowse
zy51 17 GRCz11 OTHER_MAPPING Feature location obtained from related gene that has mapped_marker info
17 GRCz11 OTHER_MAPPING featureLocationPullThruFromGenePaneledMarkers
17 GRCz11 OTHER_MAPPING featureLocationPullThruFromGeneGBrowse
zy52 17 GRCz11 OTHER_MAPPING Feature location obtained from related gene that has mapped_marker info
17 GRCz11 OTHER_MAPPING featureLocationPullThruFromGeneGBrowse
17 GRCz11 OTHER_MAPPING featureLocationPullThruFromGenePaneledMarkers
zy53 17 GRCz11 OTHER_MAPPING Feature location obtained from related gene that has mapped_marker info
17 GRCz11 OTHER_MAPPING featureLocationPullThruFromGeneGBrowse
17 GRCz11 OTHER_MAPPING featureLocationPullThruFromGenePaneledMarkers

GENETIC MAPPING PANELS
Chr Location Mapped As Panel Mapped By Scoring
17 14.0 cM dvr1 Mother of Pearl (MOP) Postlethwait, John H. Data
17 103.95 cR dvr1 Loeb/NIH/5000/4000 (LN54) Dawid, Igor B. Data
17 705.0 cR dvr1 Goodfellow T51 (T51) Geisler, Robert Data
17 9.9 cM vg1 Heat Shock (HS) Woods, Ian G. Data
Note: Physical map location as displayed in the genome browsers is more precise than linkage map location.
Physical map location should be used whenever possible.

OTHER MAPPING INFORMATION
Primer Sets:
Strain Bandsize Restriction Enzyme Annealing Temperature [C]
SJD 266 TaqI 36.0
Forward Primer GTCCATTCGTTTGATCCTAAA
Reverse Primer CAGCATCTACATGCACATTCT
Genomic Feature pr11 is an allele of gdf3
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.