ZFIN ID: ZDB-GENE-980526-70

Mapping Details

Gene Name:	homeobox B5a
Symbol:	hoxb5a

PHYSICAL MAP AND BROWSER

Genome Browser	Chr	Position	Assembly
ZFIN	3	22,447,596 - 22,449,991	GRCz12tu
NCBI Map Viewer	3	22,447,596 - 22,449,991	GRCz12tu
Ensembl	3	23,707,691 - 23,710,095	GRCz11
NCBI Map Viewer	3	23,707,700 - 23,710,095	GRCz11
UCSC	3	-	GRCz11
Vega	3	23,577,143 - 23,579,547	GRCv10

Mapped Clones containing hoxb5a
CH211-72A16	Chr: 3 Details
BUSM1-254O17	Chr: 3 Details

PHYSICAL MAPPING

Feature	Chr	Position	Assembly	Source	DetailedSource	Citations
sud125	3	23,708,312 - 23,708,318	GRCz11	DIRECT		Maeno et al., 2024
fh468Tg	3		GRCz11	OTHER_MAPPING	Feature location obtained from related gene that has mapped_marker info
	3		GRCz11	OTHER_MAPPING	featureLocationPullThruFromGeneGBrowse
	3		GRCz11	OTHER_MAPPING	featureLocationPullThruFromGeneLinkage
	3		GRCz11	OTHER_MAPPING	featureLocationPullThruFromGenePaneledMarkers
fh477	3		GRCz11	OTHER_MAPPING	Feature location obtained from related gene that has mapped_marker info
	3		GRCz11	OTHER_MAPPING	featureLocationPullThruFromGeneGBrowse
	3		GRCz11	OTHER_MAPPING	featureLocationPullThruFromGeneLinkage
	3		GRCz11	OTHER_MAPPING	featureLocationPullThruFromGenePaneledMarkers
sud125	3		GRCz11	OTHER_MAPPING	Feature location obtained from related gene that has mapped_marker info
	3		GRCz11	OTHER_MAPPING	featureLocationPullThruFromGeneGBrowse
	3		GRCz11	OTHER_MAPPING	featureLocationPullThruFromGeneLinkage
	3		GRCz11	OTHER_MAPPING	featureLocationPullThruFromGenePaneledMarkers

GENETIC MAPPING PANELS
Chr	Location	Mapped As	Panel	Mapped By	Scoring
3	46.0 cM	hoxb5a	Mother of Pearl (MOP)	Postlethwait, John H.	Data
3	181.91 cR	ZF21	Loeb/NIH/5000/4000 (LN54)	Dawid, Igor B.	Data

Note: Physical map location as displayed in the genome browsers is more precise than linkage map location. Note: Physical map location should be used whenever possible.

MAPPING FROM PUBLICATIONS
Marker	Type	Chr	Distance	Publication / Person	Comments
hoxb7a	GENE	3		Amores et al., 1998	Using overlapping PAC clones, Amores, et al. (1998. Science 282:1711-1714.) report eve1, hoxb10a, hoxb9a, hoxb8a, hoxb7a, hoxb6a, hoxb5a, hoxb4a, hoxb3a, hoxb2a, and hoxb1a are clustered on a continuous region of the genome. Subsequent mapping of one or more of these genes localize all to LG03.
hoxb2a	GENE	3		Amores et al., 1998	Using overlapping PAC clones, Amores, et al. (1998. Science 282:1711-1714.) report eve1, hoxb10a, hoxb9a, hoxb8a, hoxb7a, hoxb6a, hoxb5a, hoxb4a, hoxb3a, hoxb2a, and hoxb1a are clustered on a continuous region of the genome. Subsequent mapping of one or more of these genes localize all to LG03.
hoxb3a	GENE	3		Amores et al., 1998	Using overlapping PAC clones, Amores, et al. (1998. Science 282:1711-1714.) report eve1, hoxb10a, hoxb9a, hoxb8a, hoxb7a, hoxb6a, hoxb5a, hoxb4a, hoxb3a, hoxb2a, and hoxb1a are clustered on a continuous region of the genome. Subsequent mapping of one or more of these genes localize all to LG03.
hoxb4a	GENE	3		Amores et al., 1998	Using overlapping PAC clones, Amores, et al. (1998. Science 282:1711-1714.) report eve1, hoxb10a, hoxb9a, hoxb8a, hoxb7a, hoxb6a, hoxb5a, hoxb4a, hoxb3a, hoxb2a, and hoxb1a are clustered on a continuous region of the genome. Subsequent mapping of one or more of these genes localize all to LG03.
hoxb6a	GENE	3		Amores et al., 1998	Using overlapping PAC clones, Amores, et al. (1998. Science 282:1711-1714.) report eve1, hoxb10a, hoxb9a, hoxb8a, hoxb7a, hoxb6a, hoxb5a, hoxb4a, hoxb3a, hoxb2a, and hoxb1a are clustered on a continuous region of the genome. Subsequent mapping of one or more of these genes localize all to LG03.
hoxb8a	GENE	3		Amores et al., 1998	Using overlapping PAC clones, Amores, et al. (1998. Science 282:1711-1714.) report eve1, hoxb10a, hoxb9a, hoxb8a, hoxb7a, hoxb6a, hoxb5a, hoxb4a, hoxb3a, hoxb2a, and hoxb1a are clustered on a continuous region of the genome. Subsequent mapping of one or more of these genes localize all to LG03.
hoxb9a	GENE	3		Amores et al., 1998	Using overlapping PAC clones, Amores, et al. (1998. Science 282:1711-1714.) report eve1, hoxb10a, hoxb9a, hoxb8a, hoxb7a, hoxb6a, hoxb5a, hoxb4a, hoxb3a, hoxb2a, and hoxb1a are clustered on a continuous region of the genome. Subsequent mapping of one or more of these genes localize all to LG03.
eve1	GENE	3		Amores et al., 1998	Using overlapping PAC clones, Amores, et al. (1998. Science 282:1711-1714.) report eve1, hoxb10a, hoxb9a, hoxb8a, hoxb7a, hoxb6a, hoxb5a, hoxb4a, hoxb3a, hoxb2a, and hoxb1a are clustered on a continuous region of the genome. Subsequent mapping of one or more of these genes localize all to LG03.
hoxb1a	GENE	3		Amores et al., 1998	Using overlapping PAC clones, Amores, et al. (1998. Science 282:1711-1714.) report eve1, hoxb10a, hoxb9a, hoxb8a, hoxb7a, hoxb6a, hoxb5a, hoxb4a, hoxb3a, hoxb2a, and hoxb1a are clustered on a continuous region of the genome. Subsequent mapping of one or more of these genes localize all to LG03.
hoxb10a	GENE	3		Amores et al., 1998	Using overlapping PAC clones, Amores, et al. (1998. Science 282:1711-1714.) report eve1, hoxb10a, hoxb9a, hoxb8a, hoxb7a, hoxb6a, hoxb5a, hoxb4a, hoxb3a, hoxb2a, and hoxb1a are clustered on a continuous region of the genome. Subsequent mapping of one or more of these genes localize all to LG03.
hoxb4a	GENE	3		Woltering et al., 2006	Woltering and Durston (2006, Nat. Genet. 38(6):601-602) have mapped mirn10c between hoxb4a and hoxb5a.
mir10c	MIRNAG	3		Woltering et al., 2006	Woltering and Durston (2006, Nat. Genet. 38(6):601-602) have mapped mirn10c between hoxb4a and hoxb5a.

Chr 3	Amores et al., 1998	Using overlapping PAC clones, Amores, et al. (1998. Science 282:1711-1714.) report eve1, ...
Chr 3	Woltering et al., 2006	Woltering and Durston (2006, Nat. Genet. 38(6):601-602) have mapped mirn10c between ...

Markers Encoded by hoxb5a
fc38c09 Chr: 3 Details

Primer Sets:
Strain	Bandsize	Restriction Enzyme	Annealing Temperature [C]
SJD	1736	DraI	36.0
Forward Primer	ACACGTACACGTTTCAGTCACA
Reverse Primer	ACAGGTCAGCTTTCTCTTTTGG

Genomic Feature fh468Tg is an allele of hoxb5a