| ZFIN ID: ZDB-GENE-980526-215 |
| Gene Name: | even-skipped homeobox 2 |
|---|---|
| Symbol: | evx2 |
PHYSICAL MAP AND BROWSER
|
|
||||||||||||||||||||||||||||
|
| Mapped Clones containing evx2 | |
|---|---|
| RP71-78H1 | Chr: 9 Details |
PHYSICAL MAPPING
| Feature | Chr | Position | Assembly | Source | DetailedSource | Citations |
|---|---|---|---|---|---|---|
| sa140 | 9 | 2,001,636 | GRCz12tu | DIRECT | Sealy et al., 2025 | |
| 9 | 2,004,100 | GRCz11 | DIRECT | Busch-Nentwich et al., 2013 | ||
| 9 | 2,003,303 | GRCz10 | DIRECT | Busch-Nentwich et al., 2013 | ||
| 9 | 1,994,899 | Zv9 | DIRECT | Busch-Nentwich et al., 2013 | ||
| sa41335 | 9 | 2,001,003 | GRCz12tu | DIRECT | Sealy et al., 2025 | |
| 9 | 2,003,467 | GRCz11 | DIRECT | Busch-Nentwich et al., 2013 | ||
| 9 | 2,002,670 | GRCz10 | DIRECT | Busch-Nentwich et al., 2013 | ||
| 9 | 1,994,266 | Zv9 | DIRECT | Busch-Nentwich et al., 2013 | ||
| nns72Tg | 9 | GRCz11 | OTHER_MAPPING | Feature location obtained from related gene that has mapped_marker info | ||
| 9 | GRCz11 | OTHER_MAPPING | featureLocationPullThruFromGenePaneledMarkers | |||
| 9 | GRCz11 | OTHER_MAPPING | featureLocationPullThruFromGeneLinkage | |||
| 9 | GRCz11 | OTHER_MAPPING | featureLocationPullThruFromGeneGBrowse | |||
| sa140 | 9 | GRCz11 | OTHER_MAPPING | Feature location obtained from related gene that has mapped_marker info | ||
| 9 | GRCz11 | OTHER_MAPPING | featureLocationPullThruFromGeneLinkage | |||
| 9 | GRCz11 | OTHER_MAPPING | featureLocationPullThruFromGenePaneledMarkers | |||
| 9 | GRCz11 | OTHER_MAPPING | featureLocationPullThruFromGeneGBrowse | |||
| sa41335 | 9 | GRCz11 | OTHER_MAPPING | featureLocationPullThruFromGeneGBrowse | ||
| 9 | GRCz11 | OTHER_MAPPING | featureLocationPullThruFromGeneLinkage | |||
| 9 | GRCz11 | OTHER_MAPPING | featureLocationPullThruFromGenePaneledMarkers | |||
| 9 | GRCz11 | OTHER_MAPPING | Feature location obtained from related gene that has mapped_marker info |
| Chr | Location | Mapped As | Panel | Mapped By | Scoring |
|---|---|---|---|---|---|
| 9 | 15.7 cM | evx2 | Mother of Pearl (MOP) | Postlethwait, John H. | Data |
| 9 | 208.38 cR | Evx-2 | Loeb/NIH/5000/4000 (LN54) | Dawid, Igor B. | Data |
| 9 | 0.0 cM | evx2 | Heat Shock (HS) | Woods, Ian G. | Data |
| Note: Physical map location as
displayed in the genome browsers is more precise than linkage map location. Physical map location should be used whenever possible. |
|||||
| Marker | Type | Chr | Distance | Publication / Person | Comments |
|---|---|---|---|---|---|
| hoxd10a | GENE | 9 | Amores et al., 1998 | Using overlapping PAC clones, Amores, et al. (1998. Science 282:1711-1714.) report evx2, hoxd13a, hoxd12a, hoxd11a, hoxd10a, hoxd9a, hoxd4a, and hoxd3a are clustered on a continuous region of the genome. Subsequent mapping of one or more of these genes localize all to LG09. | |
| hoxd11a | GENE | 9 | Amores et al., 1998 | Using overlapping PAC clones, Amores, et al. (1998. Science 282:1711-1714.) report evx2, hoxd13a, hoxd12a, hoxd11a, hoxd10a, hoxd9a, hoxd4a, and hoxd3a are clustered on a continuous region of the genome. Subsequent mapping of one or more of these genes localize all to LG09. | |
| hoxd12a | GENE | 9 | Amores et al., 1998 | Using overlapping PAC clones, Amores, et al. (1998. Science 282:1711-1714.) report evx2, hoxd13a, hoxd12a, hoxd11a, hoxd10a, hoxd9a, hoxd4a, and hoxd3a are clustered on a continuous region of the genome. Subsequent mapping of one or more of these genes localize all to LG09. | |
| hoxd13a | GENE | 9 | Amores et al., 1998 | Using overlapping PAC clones, Amores, et al. (1998. Science 282:1711-1714.) report evx2, hoxd13a, hoxd12a, hoxd11a, hoxd10a, hoxd9a, hoxd4a, and hoxd3a are clustered on a continuous region of the genome. Subsequent mapping of one or more of these genes localize all to LG09. | |
| hoxd3a | GENE | 9 | Amores et al., 1998 | Using overlapping PAC clones, Amores, et al. (1998. Science 282:1711-1714.) report evx2, hoxd13a, hoxd12a, hoxd11a, hoxd10a, hoxd9a, hoxd4a, and hoxd3a are clustered on a continuous region of the genome. Subsequent mapping of one or more of these genes localize all to LG09. | |
| hoxd9a | GENE | 9 | Amores et al., 1998 | Using overlapping PAC clones, Amores, et al. (1998. Science 282:1711-1714.) report evx2, hoxd13a, hoxd12a, hoxd11a, hoxd10a, hoxd9a, hoxd4a, and hoxd3a are clustered on a continuous region of the genome. Subsequent mapping of one or more of these genes localize all to LG09. | |
| hoxd4a | GENE | 9 | Amores et al., 1998 | Using overlapping PAC clones, Amores, et al. (1998. Science 282:1711-1714.) report evx2, hoxd13a, hoxd12a, hoxd11a, hoxd10a, hoxd9a, hoxd4a, and hoxd3a are clustered on a continuous region of the genome. Subsequent mapping of one or more of these genes localize all to LG09. |
|
| Strain | Bandsize | Restriction Enzyme | Annealing Temperature [C] |
|---|---|---|---|
| SJD | 850 | 36.0 | |
| Forward Primer | AACGACAACACCTCCTCAAC | ||
| Reverse Primer | CAGTCTTCCGATCTGCTCTC |
| Genomic Feature sa41335 is an allele of evx2 |