ZFIN ID: ZDB-GENE-980526-144

Mapping Details

Gene Name: hairy-related 6
Symbol: her6
PHYSICAL MAP AND BROWSER
Genome Browser Chr Position Assembly
ZFIN 6 39,108,800 - 39,110,485 GRCz12tu
NCBI Map Viewer 6 39,108,800 - 39,110,485 GRCz12tu
Ensembl 6 36,551,083 - 36,552,844 GRCz11
NCBI Map Viewer 6 36,551,083 - 36,552,768 GRCz11
UCSC 6 - GRCz11
Vega 6 36,573,189 - 36,574,950 GRCv10
Mapped Clones containing her6
DKEY-111K7 Chr: 6 Details
PHYSICAL MAPPING
Feature Chr Position Assembly Source DetailedSource Citations
co3005 6 36,552,295 - 36,552,298 GRCz11 DIRECT Stenzel et al., 2022
sa20748 6 39,109,969 GRCz12tu DIRECT Sealy et al., 2025
6 36,552,252 GRCz11 DIRECT Busch-Nentwich et al., 2013
6 36,574,358 GRCz10 DIRECT Busch-Nentwich et al., 2013
6 36,330,824 Zv9 DIRECT Busch-Nentwich et al., 2013
sa38559 6 39,110,152 GRCz12tu DIRECT Sealy et al., 2025
6 36,552,435 GRCz11 DIRECT Busch-Nentwich et al., 2013
6 36,574,541 GRCz10 DIRECT Busch-Nentwich et al., 2013
6 36,331,007 Zv9 DIRECT Busch-Nentwich et al., 2013
sud29 6 39,110,014 - 39,110,018 GRCz12tu DIRECT Tsuruoka et al., 2025
co3005 6 GRCz11 OTHER_MAPPING featureLocationPullThruFromGeneGBrowse
6 GRCz11 OTHER_MAPPING featureLocationPullThruFromGenePaneledMarkers
6 GRCz11 OTHER_MAPPING Feature location obtained from related gene that has mapped_marker info
el633 6 GRCz11 OTHER_MAPPING featureLocationPullThruFromGeneGBrowse
6 GRCz11 OTHER_MAPPING featureLocationPullThruFromGenePaneledMarkers
6 GRCz11 OTHER_MAPPING Feature location obtained from related gene that has mapped_marker info
sa59 6 GRCz11 OTHER_MAPPING featureLocationPullThruFromGenePaneledMarkers
6 GRCz11 OTHER_MAPPING Feature location obtained from related gene that has mapped_marker info
6 GRCz11 OTHER_MAPPING featureLocationPullThruFromGeneGBrowse
sa20748 6 GRCz11 OTHER_MAPPING Feature location obtained from related gene that has mapped_marker info
6 GRCz11 OTHER_MAPPING featureLocationPullThruFromGeneGBrowse
6 GRCz11 OTHER_MAPPING featureLocationPullThruFromGenePaneledMarkers
sa38559 6 GRCz11 OTHER_MAPPING Feature location obtained from related gene that has mapped_marker info
6 GRCz11 OTHER_MAPPING featureLocationPullThruFromGeneGBrowse
6 GRCz11 OTHER_MAPPING featureLocationPullThruFromGenePaneledMarkers
umc301Tg 6 GRCz11 OTHER_MAPPING featureLocationPullThruFromGenePaneledMarkers
6 GRCz11 OTHER_MAPPING featureLocationPullThruFromGeneGBrowse
6 GRCz11 OTHER_MAPPING Feature location obtained from related gene that has mapped_marker info

GENETIC MAPPING PANELS
Chr Location Mapped As Panel Mapped By Scoring
6 134.1 cM her6 Mother of Pearl (MOP) Postlethwait, John H. Data
6 352.38 cR HER-6 Loeb/NIH/5000/4000 (LN54) Dawid, Igor B. Data
6 74.43 cM her6 Gates et al (GAT) Talbot, William S. Data
Note: Physical map location as displayed in the genome browsers is more precise than linkage map location.
Physical map location should be used whenever possible.

OTHER MAPPING INFORMATION
Primer Sets:
Strain Bandsize Restriction Enzyme Annealing Temperature [C]
SJD 419 36.0
Forward Primer GCAACCGACGGACAGTTCGC
Reverse Primer AACGTGGAAAGATACCGCAAATA
Genomic Feature sa20748 is an allele of her6