Transcript

thoc2-202

ID
ZDB-TSCRIPT-090929-8918
Name
thoc2-202
Previous Names
  • thoc2-007
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000026227 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000026227|OTTDARG00000020835|ZDB-GENE-030616-54 thoc2|OTTDARP00000021534 thoc2-007 LG_none BX470260.10,BX510993.6,BX511226.5 Danio rerio protein_coding KNOWN, 5492 bp
TCTGAGAGTGTGGAGGAAGATGGCGGCGCTGATCCTCCCG
TTTGACTGGTTAAAAAACTGGGACAAATCCGGCAGAAATG
AGTTTTTACAGTTTTTTCAAGACCTTGCAGGGAAATCAAG
TGGTCATGAGTTGGTTAAAGATCTGCAGACAGCCTTTTAC
GAGCTTTGTTGGCATGCTATCCAGGGCAGTCTGAAGGTGG
ATGTGGCTGCTAGTCTCCTGGCTGATGTTATGGAACTGCG
GGATGATATGCCTTCTATTTTAGCTGATGTTCTCTGTATA
TTAGATATTGAGACTGGTTGTTTGGAGGAGAAACACAAAC
GGGATCTTTTTACCCAGTTGGTTGGAGCCTGTTTGATCTG
TATTCCTGATGGTGTACTAAAGGAGAGATTAGATCCCGAA
ACACTGGAGTCTCTGGGGCTGATTAAACAAGCTCAACAGT
TCAATCAGAAGATTGTGAAAATCAAGACCAAACTGTTTTA
CAAACAGCAAAAGTTCAATTTGTTGCGTGAGGAGAATGAA
GGTTATGCTAAACTGATCACAGAGCTTGGCCAAGATCTGA
CCGGGAATCTCACCAGTCACATCGTCCTTGAGAACATCAA
GTCATTAATAGGATGTTTCAATTTGGACCCAAACCGTGTG
CTGGACATCATTTTGGAGGTGTATGAATGTCGCTCTGACC
AGGATGAGTTTTTTATTCCTCTAATCAAGTCCTACATGTG
CGAGCACCAGACCCTGTGTCACATGCTCGGTTTCAAGTTC
AAATTCCACCAGGAGCCTAATGGAGAAACACCATCATCTC
TGTATCACATCGCTGCAGCTCTTCTTCAGCATGACCTCAT
CGCTCTTGAAGACCTCTATGTTCATCTTCTCCCACTGGAT
TCCAGCATTGTGGAAGAGCACAAGAGAGATATCCTAGAGG
CCAAGCAGATTGCCCGTAAACTCACGATGGTGGTCCTACC
CTCTGAAAAGACAGAGGACAAGGAGAAAGAAAAGGACAAG
GAAGAAGAAAAAAACGAGAAGCCTCCTGATAACCAGAAGT
TGGGACTGCTTGAGGCACTACTGAGGATCAGTGACTGGCA
GCACTCTCAGAGCATCATGGATCAATTGCCAGCTTTCTAT
GCCACCTCCCACAAGGCCATCGCTGTTGCACTGTGCCAGC
TGCTTCACCTGATCATAGATCCACTCTACCGCAGGGCTGG
AGTACCAAAAGGTGCCAAAGGCAGTTTGATAACACCTCTG
CAGAACAAACATGCACCCCAGCCCGCCGAAAACTTTGATG
ATCTATCCAGGGATGTCTTCACCATGTTATGCTACCTGGG
ACCTCACCTGTCTCATGATCCCATCCTTTTTGCGAAGATG
GTGCGGCTGGGAAAGAGTTTCATGAAAGAGTACCAAAGTG
AAAGCAGGCAAGACAGCAGGGACAAAATGGACTCTCTACT
GGGCAGTTTTCTCAGTATTGCTGATCAGGTGCTGTTACCA
TCACTCTCGCTTATGGAGTGCAATGCCTGCATGTCTGAGG
AACTCTGGGGCTTTTTTAAATTCTTCCCTTACCAGCACAG
GTATCGTCTCTATGGGCAATGGAAAAATGAGACATACAGC
AATCATCCACTCCTGGTGAAGATCAAGGCTCAGACAGTGG
ATAGATCCAAATACATCATGAAGCGGCTCACCAAGGAGAA
TGTTAAGCCCTCTGGAAGGCAGATAGGAAAGTTAAGCCAC
AGCAACCCCACCATTCTCTTCGATTATATTCTGTCTCAGA
TCCAGTGGTACGACAACCTCATAACTCCAGTGGTGGACTC
TCTCAAATACTTAACATCTCTCAACTATGATGTACTGGCC
TATTGCATTATTGAAGCTTTAGCCAACCCAGAGAAAGAGA
AGATGAAACATGATGACACAACCATTTCATCATGGTTGCA
GAGTCTTGCAAGTCTTTGTGGAGCAGTTTTCAGGAAATAT
CCTATTGAGTTAGCAGGTCTTCTCCAGTACGTAACCAACC
AGCTTAAAGCAGGGAAGAGTTTTGACCTGCTGATCCTGAA
GGAGGTGGTGCAGAAGATGGCAGGAATTGAGATAACAGAT
GAAATGACTGTGGAGCAGTTGGAGGCCATGACAGGTGGAG
AACAACTCAAAGCAGAGGGTGGTTACTTTGGACAGATTAG
AAACACTAAGAAATCTTCTCAGCGTCTGAAGGATGCTCTT
TTGGATCATGAGCTGGCATTACCTCTGTGTCTACTGATGG
CCCAGCAGAGGAATGGAGTGGTGTTCTCTGAGGGGGGAGA
AAAGCATCTAAAACTTGTGGGAAAGCTTTATGATCAGTGT
CATGACACTCTTGTGCAGTTTGGTGGCTTTTTGGCATCTA
ACCTCAGTACAGAAGACTACATTAAAAGGGTACCCTCAGT
TGACGTCCTCTGCAACCAGTTACACACACCACATGATGCT
GCGTTTTTCCTGTCTCGCCCGATGTATGCCCATCAGATCC
TGTCCAAGTATGATGAATTGAAAAAGGCAGAGAAGGGGAA
CAGGCAGCAGCAGAAAGTCCATAAGTACATCACAGCCTGC
GAGCAGGTTATGGCTCCTGTTCATGAGGCTGTCGTGTCTC
TTCATTTGCCAAAGGTGTGGGATGATCTTCGACCACAATT
CTACGCCACATTCTGGTCCCTCACCATGTATGACCTGGCA
GTACCACACAATGCCTACGACCGAGAAGTCAACAAGCTTA
AGATGCAGATCAAATCCATTGATGATAACACTGAGATGCC
TCCAAATAAAAAGAAAAAGGAGAAGGAACGCTGTACAGCT
CTGCAGGACAAGCTACAAGAAGAGGAGAAGAAACAGTTGG
AGCATGTGCAGAGAGTTCTGCATCGTCTCAAACTGGAGAA
AGACAATTGGTTACTCGCCAAATCCACTAAGAATGAAACC
ATCACTAAGTTCCTTCAGCTCTGCATCTTCCCCCGTTGTG
TCTTCTCAGCCATTGATGCTGTTTACTGCGCTCGCTTTGT
GGAGCTGGTTCACCAGCAGAAAACGCCCAACTTCTGCACC
CTACTTTGCTATGACAGAGTCTTCTCTGATATCATCTATA
CGGTAGCGAGTTGCACAGAGAATGAGTCCCGCCGATATGG
TCGTTTTTTGTGTTGCATGTTAGAGACTGTCACTCGATGG
CACAGTGACAGAGCCATTTATGAGAAGGAATGTGGTAATT
ACCCAGGGTTCCTGACTATTTTCCGAGCCAGTGGTTTCGA
CGGAGGGAACAAAGCAGATCAATTGGACTATGAGAATTTT
CGACATGTTGTCCACAAATGGCATTACAAGTTGACTAAAG
CATCTGTTCACTGTCTAGAAACGGGTGAGTACACCCACAT
TCGCAACATTCTGATCGTGCTTACCAAGATCCTACCCTGG
TACCCCAAGGTGCTGAACCTAGGCCAGGCTTTGGAGTGTC
GCGTTCACAAGATCTGCCAGGAAGAGAAGGAGAAGAGGCC
TGATCTCTATGCATTAGCCATGGGTTACTCAGGCCAATTG
AAAGGCAGAAAAGTGCATATGGTGCCTGAAAATGAGTTCC
ACCACAAGGAGCAACCAGTACGCAGCACCACGACCGGCAC
TCTGCAAAATGGACCTGGGAATATAGGCAAGACTTCAACC
ACTACCGCTGCCAGTGCTGGAAAAACTGAGGATGGTGTCG
TCGAGGACTCAGAGAAATCCAAGGACAAATCACAGGCAGC
CCAAAAAACTGCCAGTAAAAACAGCACAACAGCCAATAAA
GTGAGCAGCAGCAATGGAAGCAGCACGCCAAACAGCATGA
AAGGGAGCAAAGAGAAGGAGGACAAAGAAAAGACCACAAA
AGAGAAAAAGGAGAAAAAAGAAAAGAACCCAGGGAGCACT
CCAGAGGCCAAGACAGGAGCGAAAGACAAGCAAAAGGAAG
AAAGGTCTAAGGAAGAGAAGCCCATCGACAGCAAGGAGAA
GACACCCAAGGCAGACAAGGACAAGAGGAAGGATGACAAG
AAGGAAGAGAAGAGCAAAATCGACGGGAAATCCATTGAAA
AAGATTGGTCCAAAGAACGTGATGCGTCCAGTGACAGCAA
GACAAAGGAAAGCAGCAAGTTGGAGAAGAATGCTGGGGCT
GGAAGCCTGAAGTCCCTTGTTCCCAGATCTGAAGGAGTTG
AGTCTGAACGGGAGCAAAAAAGACGAAAGCTCGACACTCA
CTCGTCGCCATCACACTCCTCTGCAGTTAAGGACAATCTC
AACGACTTCAAGGACTCCACATTAAAGCACCATCCTAACC
ACACCACAGTCCTGTCCAAGATCAAAGAGAAGGATGATGA
GAAGAAAGAGTCTGATAAATCCAGGGACCGCTCCAAAGAG
AGGGAAAAGAAAGAAGACCGGAAGGACCGAAAACGAGACT
ACTTGAACAGCGATCGCGAGATGAGCCAGGAAGCCAAACG
CCGCAAAGATGAAAATGGAATGAGCTCATCCAAACACAGC
AAGAGTGCCAGCCCCTCTGAATCACCACACTCCAATGACA
AGGACAATAGTAAACGCTCCAAGTCCACCAGCAAGGACAA
GAGTGATCTGGCCAAATTGGAGAAGACCTCTGGAGGCAAA
AAGGAATCCAGGCATGACAAAGAGAAATCAGAAAAAAAGA
GAGACAGCACTGGAACTAAAGAGGAGAAAAAACACCATAA
ATCATCAGAAAAGCACAGATAATGTATGCAGACTCTCAAG
AAGGTTTTGCGGACCTCACGCATTCCTGAATCACATTGGC
TGCAGTTGTTCCTCTTTACCAATATTCCCTGCCATGGGCT
GATACAGGATGCAAGATTGATCATCCCAAGCTTTCTCAAC
ATTGTAATTTTCTTCTCCTTTCACTTTCTGGAAAATGGAT
TCTCTCACATGCTTTGGAGTTTTGCCTGCATTTAAACTTT
TTCTGTTGTTTTGCCTAGACATGTTGTAGCTCGTCTTTTA
ATCTGCAATTTTTATTGTGATATTTTCAGTACTTGACTGA
AAGTTTGTTTCCTTTAAATATTTAGCACAATGTGCTTCTT
GCATCACAAACAGATTCAGGTTTAATTGGTGTTTCTCCCA
AATGCTTGCATTTTTATGACCTCAATCTATTATCTTCTTT
CTTTCTTTTTTTTTTAAGTTTTTTGTTTTCCTTGAATACT
CTTCTTTTTTTTCCTTTTTAATTCACATGTGATATTTAGA
CTAGTTATTTGAAGCCGTACAGATGCTCTATTTGTATATT
ATGTATACAGAAATAAAATGGTTCCATGTAATAAGACATT
TCCTGTTAATTTTTTCCCCAATTGTAAGGCTCTTGATTTT
TTTTTTGTGTTCAATCACATTTTTAAAACATTTGTATAGA
GAACAGCAAGCTGGATTTTCTTCATAAATAAAACGGAAAC
AATTCATAACTTCTCAAATTACTTAATGGAGTTTTTATCT
GTCAAAATCTGCAGTGTATGCTTTTTCTAAATAAACTAGT
TTTCTTAGTGTA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations