Transcript

thoc2-001

ID
ZDB-TSCRIPT-090929-8912
Name
thoc2-001
Previous Names
None
Transcript Type
ncRNA
Annotation Status
artifact
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000026221 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000026221|OTTDARG00000020835|ZDB-GENE-030616-54 thoc2|no_translation thoc2-001 LG_none BX470260.10,BX510993.6,BX511226.5 Danio rerio protein_coding KNOWN, 5471 bp
TCTGAGAGTGTGGAGGAAGATGGCGGCGCTGATCCTCCCG
TTTGACTGGTTAAAAAACTGGGACAAATCCGGCAGAAATG
AGTTTTTACAGTTTTTTCAAGACCTTGCAGGGAAATCAAG
TGGTCATGAGTTGGTTAAAGATCTGCAGACAGCCTTTTAC
GAGCTTTGTTGGCATGCTATCCAGGGCAGTCTGAAGGTGG
ATGTGGCTGCTAGTCTCCTGGCTGATGTTATGGAACTGCG
GGATGATATGCCTTCTATTTTAGCTGATGTTCTCTGTATA
TTAGATATTGAGACTGGTTGTTTGGAGGAGAAACACAAAC
GGGATCTTTTTACCCAGTTGGTTGGAGCCTGTTTGATCTG
TATTCCTGATGGTGTACTAAAGGAGAGATTAGATCCCGAA
ACACTGGAGTCTCTGGGGCTGATTAAACAAGCTCAACAGT
TCAATCAGAAGATTGTGAAAATCAAGACCAAACTGTTTTA
CAAACAGCAAAAGTTCAATTTGTTGCGTGAGGAGAATGAA
GGTTATGCTAAACTGATCACAGAGCTTGGCCAAGATCTGA
CCGGGAATCTCACCAGTCACATCGTCCTTGAGAACATCAA
GTCATTAATAGGATGTTTCAATTTGGACCCAAACCGTGTG
CTGGACATCATTTTGGAGGTGTATGAATGTCGCTCTGACC
AGGATGAGTTTTTTATTCCTCTAATCAAGTCCTACATGTG
CGAGCACCAGACCCTGTGTCACATGCTCGGTTTCAAGTTC
AAATTCCACCAGGAGCCTAATGGAGAAACACCATCATCTC
TGTATCACATCGCTGCAGCTCTTCTTCAGCATGACCTCAT
CGCTCTTGAAGACCTCTATGTTCATCTTCTCCCACTGGAT
TCCAGCATTGTGGAAGAGCACAAGAGAGATATCCTAGAGG
CCAAGCAGATTGCCCGTAAACTCACGATGGTGGTCCTACC
CTCTGAAAAGACAGAGGACAAGGAGAAAGAAAAGGACAAG
GAAGAAGAAAAAAACGAGAAGCCTCCTGATAACCAGAAGT
TGGGACTGCTTGAGGCACTACTGAGGATCAGTGACTGGCA
GCACTCTCAGAGCATCATGGATCAATTGCCAGCTTTCTAT
GCCACCTCCCACAAGGCCATCGCTGTTGCACTGTGCCAGC
TGCTTCACCTGATCATAGATCCACTCTACCGCAGGGCTGG
AGTACCAAAAGGTGCCAAAGGCAGTTTGATAACACCTCTG
CAGAACAAACATGCACCCCAGCCCGCCGAAAACTTTGATG
ATCTATCCAGGGATGTCTTCACCATGTTATGCTACCTGGG
ACCTCACCTGTCTCATGATCCCATCCTTTTTGCGAAGATG
GTGCGGCTGGGAAAGAGTTTCATGAAAGAGGACTCTCTAC
TGGGCAGTTTTCTCAGTATTGCTGATCAGGTGCTGTTACC
ATCACTCTCGCTTATGGAGTGCAATGCCTGCATGTCTGAG
GAACTCTGGGGCTTTTTTAAATTCTTCCCTTACCAGCACA
GGTATCGTCTCTATGGGCAATGGAAAAATGAGACATACAG
CAATCATCCACTCCTGGTGAAGATCAAGGCTCAGACAGTG
GATAGATCCAAATACATCATGAAGCGGCTCACCAAGGAGA
ATGTTAAGCCCTCTGGAAGGCAGATAGGAAAGTTAAGCCA
CAGCAACCCCACCATTCTCTTCGATTATATTCTGTCTCAG
ATCCAGTGGTACGACAACCTCATAACTCCAGTGGTGGACT
CTCTCAAATACTTAACATCTCTCAACTATGATGTACTGGC
CTATTGCATTATTGAAGCTTTAGCCAACCCAGAGAAAGAG
AAGATGAAACATGATGACACAACCATTTCATCATGGTTGC
AGAGTCTTGCAAGTCTTTGTGGAGCAGTTTTCAGGAAATA
TCCTATTGAGTTAGCAGGTCTTCTCCAGTACGTAACCAAC
CAGCTTAAAGCAGGGAAGAGTTTTGACCTGCTGATCCTGA
AGGAGGTGGTGCAGAAGATGGCAGGAATTGAGATAACAGA
TGAAATGACTGTGGAGCAGTTGGAGGCCATGACAGGTGGA
GAACAACTCAAAGCAGAGGGTGGTTACTTTGGACAGATTA
GAAACACTAAGAAATCTTCTCAGCGTCTGAAGGATGCTCT
TTTGGATCATGAGCTGGCATTACCTCTGTGTCTACTGATG
GCCCAGCAGAGGAATGGAGTGGTGTTCTCTGAGGGGGGAG
AAAAGCATCTAAAACTTGTGGGAAAGCTTTATGATCAGTG
TCATGACACTCTTGTGCAGTTTGGTGGCTTTTTGGCATCT
AACCTCAGTACAGAAGACTACATTAAAAGGGTACCCTCAG
TTGACGTCCTCTGCAACCAGTTACACACACCACATGATGC
TGCGTTTTTCCTGTCTCGCCCGATGTATGCCCATCAGATC
CTGTCCAAGTATGATGAATTGAAAAAGGCAGAGAAGGGGA
ACAGGCAGCAGCAGAAAGTCCATAAGTACATCACAGCCTG
CGAGCAGGTTATGGCTCCTGTTCATGAGGCTGTCGTGTCT
CTTCATTTGCCAAAGGTGTGGGATGATCTTCGACCACAAT
TCTACGCCACATTCTGGTCCCTCACCATGTATGACCTGGC
AGTACCACACAATGCCTACGACCGAGAAGTCAACAAGCTT
AAGATGCAGATCAAATCCATTGATGATAACACTGAGATGC
CTCCAAATAAAAAGAAAAAGGAGAAGGAACGCTGTACAGC
TCTGCAGGACAAGCTACAAGAAGAGGAGAAGAAACAGTTG
GAGCATGTGCAGAGAGTTCTGCATCGTCTCAAACTGGAGA
AAGACAATTGGTTACTCGCCAAATCCACTAAGAATGAAAC
CATCACTAAGTTCCTTCAGCTCTGCATCTTCCCCCGTTGT
GTCTTCTCAGCCATTGATGCTGTTTACTGCGCTCGCTTTG
TGGAGCTGGTTCACCAGCAGAAAACGCCCAACTTCTGCAC
CCTACTTTGCTATGACAGAGTCTTCTCTGATATCATCTAT
ACGGTAGCGAGTTGCACAGAGAATGAGTCCCGCCGATATG
GTCGTTTTTTGTGTTGCATGTTAGAGACTGTCACTCGATG
GCACAGTGACAGAGCCATTTATGAGAAGGAATGTGGTAAT
TACCCAGGGTTCCTGACTATTTTCCGAGCCAGTGGTTTCG
ACGGAGGGAACAAAGCAGATCAATTGGACTATGAGAATTT
TCGACATGTTGTCCACAAATGGCATTACAAGTTGACTAAA
GCATCTGTTCACTGTCTAGAAACGGGTGAGTACACCCACA
TTCGCAACATTCTGATCGTGCTTACCAAGATCCTACCCTG
GTACCCCAAGGTGCTGAACCTAGGCCAGGCTTTGGAGTGT
CGCGTTCACAAGATCTGCCAGGAAGAGAAGGAGAAGAGGC
CTGATCTCTATGCATTAGCCATGGGTTACTCAGGCCAATT
GAAAGGCAGAAAAGTGCATATGGTGCCTGAAAATGAGTTC
CACCACAAGGAGCAACCAGTACGCAGCACCACGACCGGCA
CTCTGCAAAATGGACCTGGGAATATAGGCAAGACTTCAAC
CACTACCGCTGCCAGTGCTGGAAAAACTGAGGATGGTGTC
GTCGAGGACTCAGAGAAATCCAAGGACAAATCACAGGCAG
CCCAAAAAACTGCCAGTAAAAACAGCACAACAGCCAATAA
AGTGAGCAGCAGCAATGGAAGCAGCACGCCAAACAGCATG
AAAGGGAGCAAAGAGAAGGAGGACAAAGAAAAGACCACAA
AAGAGAAAAAGGAGAAAAAAGAAAAGAACCCAGGGAGCAC
TCCAGAGGCCAAGACAGGAGCGAAAGACAAGCAAAAGGAA
GAAAGGTCTAAGGAAGAGAAGCCCATCGACAGCAAGGAGA
AGACACCCAAGGCAGACAAGGACAAGAGGAAGGATGACAA
GAAGGAAGAGAAGAGCAAAATCGACGGGAAATCCATTGAA
AAAGATTGGTCCAAAGAACGTGATGCGTCCAGTGACAGCA
AGACAAAGGAAAGCAGCAAGTTGGAGAAGAATGCTGGGGC
TGGAAGCCTGAAGTCCCTTGTTCCCAGATCTGAAGGAGTT
GAGTCTGAACGGGAGCAAAAAAGACGAAAGCTCGACACTC
ACTCGTCGCCATCACACTCCTCTGCAGTTAAGCACCATCC
TAACCACACCACAGTCCTGTCCAAGATCAAAGAGAAGGAT
GATGAGAAGAAAGAGTCTGATAAATCCAGGGACCGCTCCA
AAGAGAGGGAAAAGAAAGAAGACCGGAAGGACCGAAAACG
AGACTACTTGAACAGCGATCGCGAGATGAGCCAGGAAGCC
AAACGCCGCAAAGATGAAAATGGAATGACAAGAGTGCCAG
CCCCTCTGAATCACCACACTCCAATGACAAGGACAATAGT
AAACGAATCCAGGCATGACAAAGAGAAATCAGAAAAAAAG
AGAGACAGCACTGGAACTAAAGAGGAGAAAAAACAATATC
CTTTGAAGCTTTAGATTCCAACAGCAGTACAGAAATGAAG
AGTTACCGTTTACTTATAATTGTTTAGAAATCACTATTAC
ACCTTTGCATACATGCATGAGTAAGCATACTCTGTTTCCT
TGACATTTTTCACCCATAAATCATCAGAAAAGCACAGATA
ATGTATGCAGACTCTCAAGAAGGTTTTGCGGACCTCACGC
ATTCCTGAATCACATTGGCTGCAGTTGTTCCTCTTTACCA
ATATTCCCTGCCATGGGCTGATACAGGATGCAAGATTGAT
CATCCCAAGCTTTCTCAACATTGTAATTTTCTTCTCCTTT
CACTTTCTGGAAAATGGATTCTCTCACATGCTTTGGAGTT
TTGCCTGCATTTAAACTTTTTCTGTTGTTTTGCCTAGACA
TGTTGTAGCTCGTCTTTTAATCTGCAATTTTTATTGTGAT
ATTTTCAGTACTTGACTGAAAGTTTGTTTCCTTTAAATAT
TTAGCACAATGTGCTTCTTGCATCACAAACAGATTCAGGT
TTAATTGGTGTTTCTCCCAAATGCTTGCATTTTTATGACC
TCAATCTATTATCTTCTTTCTTTCTTTTTTTTTTAAGTTT
TTTGTTTTCCTTGAATACTCTTCTTTTTTTTCCTTTTTAA
TTCACATGTGATATTTAGACTAGTTATTTGAAGCCGTACA
GATGCTCTATTTGTATATTATGTATACAGAAATAAAATGG
TTCCATGTAATAAGACATTTCCTGTTAATTTTTTCCCCAA
TTGTAAGGCTCTTGATTTTTTTTTTGTGTTCAATCACATT
TTTAAAACATTTGTATAGAGAACAGCAAGCTGGATTTTCT
TCATAAATAAAACGGAAACAATTCATAACTTCTCAAATTA
CTTAATGGAGTTTTTATCTGTCAAAATCTGCAGTGTATGC
TTTTTCTAAATAAACTAGTTTTCTTAGTGTA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations