Transcript

thoc2-002

ID
ZDB-TSCRIPT-090929-8913
Name
thoc2-002
Previous Names
None
Transcript Type
ncRNA
Annotation Status
retained intron
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000026222 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000026222|OTTDARG00000020835|ZDB-GENE-030616-54 thoc2|no_translation thoc2-002 LG_none BX470260.10,BX510993.6,BX511226.5 Danio rerio protein_coding KNOWN, 352 bp
GGAAGATGGCGGCGCTGATCCTCCCGTTTGACTGGTTAAA
AAACTGGGACAAATCCGGCAGAAATGAGTTTTTACAGTTT
TTTCAAGACCTTGCAGGGAAATCAAGTGGTCATGAGTTGG
TTAAAGATCTGCAGACAGCCTTTTACGAGCTTTGTTGGCA
TGCTATCCAGGGCAGTCTGAAGGTGGATGTGGCTGCTAGT
CTCCTGGCTGATGTTATGGAACTGCGGGATGATATGCCTT
CTATTTTAGCTGATGTTCTCTGTATATTAGGTAAGTATTG
CGATATGTTTATACATGCTGATTAAAAGATGTTGGCCAAG
CATAAAAAAAAAATGCCATCTCATTTTTGTTG

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations