TALEN

TALEN2-fzd4

ID
ZDB-TALEN-200529-1
Name
TALEN2-fzd4
Previous Names
None
Target
Target Sequence 1
5' - TGCGACCCGATCCGCATCT - 3'
Target Sequence 2
5' - TCTTGGTCACATTGTAGCCT - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
Genomic Feature Affected Genomic Regions
zf3345 fzd4
Expression
Gene expression in Wild Types + TALEN2-fzd4
No data available
Phenotype
Phenotype resulting from TALEN2-fzd4
No data available
Phenotype of all Fish created by or utilizing TALEN2-fzd4
Phenotype Fish Conditions Figures
optokinetic behavior process quality, abnormal fzd4zf3345/zf3345(AB) standard conditions Fig. 6 from Caceres et al., 2019
retina vasculature area density, abnormal fzd4zf3345/zf3345; y1Tg(AB) standard conditions Fig. 4 with imageFig. 5 from Caceres et al., 2019
retina blood vasculature morphology, abnormal fzd4zf3345/zf3345; y1Tg(AB) standard conditions Fig. 3 with image from Caceres et al., 2019
retina vasculature fzd4 expression decreased amount, abnormal fzd4zf3345/zf3345; y1Tg(AB) standard conditions Fig. 7 with image from Caceres et al., 2019
capillary decreased distance capillary, abnormal fzd4zf3345/zf3345; y1Tg(AB) standard conditions Fig. 5 from Caceres et al., 2019
blood vessel endothelium fused with blood vessel endothelium, abnormal fzd4zf3345/zf3345; y1Tg(AB) standard conditions Fig. 2 with imageFig. 3 with imageFig. 4 with image from Caceres et al., 2019
ocular blood vessel ventral margin morphology, abnormal fzd4zf3345/zf3345; y1Tg(AB) standard conditions Fig. 3 with image from Caceres et al., 2019
retina vasculature development increased occurrence, abnormal fzd4zf3345/zf3345; y1Tg(AB) standard conditions Fig. 5 from Caceres et al., 2019
retina blood vessel increased amount, abnormal fzd4zf3345/zf3345; y1Tg(AB) standard conditions Fig. 1 with imageFig. 2 with imageFig. 4 with image from Caceres et al., 2019
retina vasculature disorganized, abnormal fzd4zf3345/zf3345; y1Tg(AB) standard conditions Fig. 1 with imageFig. 2 with image from Caceres et al., 2019
retina endothelial cell proliferation increased occurrence, abnormal fzd4zf3345/zf3345; y1Tg(AB) standard conditions Fig. 4 with image from Caceres et al., 2019
Citations