TALEN

TALEN1-irx7

ID

ZDB-TALEN-160204-1

Name

TALEN1-irx7

Previous Names

None

Target

irx7 (1)

Target Sequence 1

5' - TGGACAGAAACATCAACATG - 3'

Target Sequence 2

5' - TTCCAGGTGGGCAGCCTAAT - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Constructs

No data available

Genomic Features

Genomic Feature	Affected Genomic Regions
el538	irx7
el540	irx7

Expression

Gene expression in Wild Types + TALEN1-irx7

No data available

Phenotype

Phenotype resulting from TALEN1-irx7

No data available

Phenotype of all Fish created by or utilizing TALEN1-irx7

Phenotype	Fish	Conditions	Figures
interhyal-hyosymplectic joint cartilage development increased process quality, abnormal	irx7^el538/el538	standard conditions	Fig. 2 , Fig. 3 from Askary et al., 2015
hyosymplectic cartilage fused with interhyal cartilage, abnormal	irx7^el538/el538	standard conditions	Fig. 2 from Askary et al., 2015
pharyngeal arch 2 skeleton joint acana expression increased amount, abnormal	irx7^el538/el538	standard conditions	Fig. 3 from Askary et al., 2015
ceratohyal-interhyal joint chondrocyte increased size, abnormal	irx7^el538/el538	standard conditions	Fig. 2 from Askary et al., 2015
ceratohyal-interhyal joint cartilage development increased process quality, abnormal	irx7^el538/el538	standard conditions	Fig. 2 , Fig. 3 from Askary et al., 2015
interhyal-hyosymplectic joint chondrocyte increased size, abnormal	irx7^el538/el538	standard conditions	Fig. 2 from Askary et al., 2015
interhyal-hyosymplectic joint malformed, abnormal	irx7^el538/el538	standard conditions	Fig. 2 from Askary et al., 2015
ceratohyal cartilage fused with interhyal cartilage, abnormal	irx7^el538/el538	standard conditions	Fig. 2 from Askary et al., 2015
pharyngeal arch 2 skeleton joint col2a1a expression increased amount, abnormal	irx7^el538/el538	standard conditions	Fig. 3 from Askary et al., 2015
pharyngeal arch 2 skeleton embryonic skeletal joint development decreased process quality, abnormal	irx7^el538/el538	standard conditions	Fig. 2 , Fig. 3 from Askary et al., 2015
ceratohyal-interhyal joint malformed, abnormal	irx7^el538/el538	standard conditions	Fig. 2 from Askary et al., 2015
Meckel's cartilage absent, abnormal	irx7^el540/el540	standard conditions	Fig. 3 from Farmer et al., 2021
palatoquadrate arch fused with hyomandibula, abnormal	irx7^el540/el540	standard conditions	Fig. 6 from Farmer et al., 2021
ceratobranchial cartilage absent, abnormal	irx7^el540/el540	standard conditions	Fig. 3 from Farmer et al., 2021
palatoquadrate cartilage absent, abnormal	irx7^el540/el540	standard conditions	Fig. 3 from Farmer et al., 2021
ceratohyal cartilage decreased size, abnormal	irx7^el540/el540	standard conditions	Fig. 3 from Farmer et al., 2021
Meckel's cartilage fused with ceratohyal bone, abnormal	irx7^el540/el540	standard conditions	Fig. 6 from Farmer et al., 2021
quadrate fused with anguloarticular, abnormal	irx7^el540/el540	standard conditions	Fig. 6 from Farmer et al., 2021
ceratohyal bone fused with ceratobranchial 1 bone, abnormal	irx7^el540/el540	standard conditions	Fig. 6 from Farmer et al., 2021
interhyal-hyosymplectic joint chondrocyte EGFP expression increased amount, abnormal	irx7^el538/el538; el10Tg; el483Tg	standard conditions	Fig. 4 from Askary et al., 2015
ceratohyal-interhyal joint chondrocyte EGFP expression increased amount, abnormal	irx7^el538/el538; el10Tg; el483Tg	standard conditions	Fig. 4 from Askary et al., 2015
interhyal-hyosymplectic joint chondrocyte EGFP expression increased amount, abnormal	irx7^el538/el538; el10Tg; nu13Tg	standard conditions	Fig. 4 from Askary et al., 2015
ceratohyal-interhyal joint chondrocyte EGFP expression increased amount, abnormal	irx7^el538/el538; el10Tg; nu13Tg	standard conditions	Fig. 4 from Askary et al., 2015
interhyal-hyosymplectic joint cartilage development increased process quality, abnormal	irx5a^el574/el574; irx7^el538/el538	standard conditions	Fig. 2 from Askary et al., 2015
ceratohyal-interhyal joint chondrocyte development increased process quality, abnormal	irx5a^el574/el574; irx7^el538/el538	standard conditions	Fig. 3 from Askary et al., 2015
ceratohyal-interhyal joint absent, abnormal	irx5a^el574/el574; irx7^el538/el538	standard conditions	Fig. 6 from Askary et al., 2017
hyosymplectic cartilage fused with interhyal cartilage, abnormal	irx5a^el574/el574; irx7^el538/el538	standard conditions	Fig. 6 from Askary et al., 2017 Fig. 2 from Askary et al., 2015
pharyngeal arch 2 skeleton joint ab1-col2a labeling increased amount, abnormal	irx5a^el574/el574; irx7^el538/el538	standard conditions	Fig. 3 from Askary et al., 2015
pharyngeal arch 2 skeleton lacks all parts of type interhyal-hyosymplectic joint, abnormal	irx5a^el574/el574; irx7^el538/el538	standard conditions	Fig. 2 from Askary et al., 2015
ceratohyal cartilage fused with interhyal cartilage, abnormal	irx5a^el574/el574; irx7^el538/el538	standard conditions	Fig. 6 from Askary et al., 2017 Fig. 2 from Askary et al., 2015
ceratohyal-interhyal joint chondrocyte increased size, abnormal	irx5a^el574/el574; irx7^el538/el538	standard conditions	Fig. 2 from Askary et al., 2015
interhyal-hyosymplectic joint absent, abnormal	irx5a^el574/el574; irx7^el538/el538	standard conditions	Fig. 6 from Askary et al., 2017
symplectic decreased length, abnormal	irx5a^el574/el574; irx7^el538/el538	standard conditions	Fig. 6 from Askary et al., 2017
interhyal-hyosymplectic joint malformed, abnormal	irx5a^el574/el574; irx7^el538/el538	standard conditions	Fig. 2 from Askary et al., 2015
interhyal-hyosymplectic joint chondrocyte development increased process quality, abnormal	irx5a^el574/el574; irx7^el538/el538	standard conditions	Fig. 3 from Askary et al., 2015
interhyal-hyosymplectic joint chondrocyte increased size, abnormal	irx5a^el574/el574; irx7^el538/el538	standard conditions	Fig. 2 from Askary et al., 2015
pharyngeal arch 2 skeleton embryonic skeletal joint development decreased process quality, abnormal	irx5a^el574/el574; irx7^el538/el538	standard conditions	Fig. 2 , Fig. 3 from Askary et al., 2015
ceratohyal-interhyal joint cartilage development increased process quality, abnormal	irx5a^el574/el574; irx7^el538/el538	standard conditions	Fig. 2 from Askary et al., 2015
ceratohyal-interhyal joint malformed, abnormal	irx5a^el574/el574; irx7^el538/el538	standard conditions	Fig. 2 from Askary et al., 2015
pharyngeal arch 2 skeleton embryonic skeletal joint development decreased process quality, abnormal	irx7^el538/el538; trps1^j1271aGt; el10Tg	standard conditions	Fig. 3 from Askary et al., 2015
pharyngeal arch 2 skeleton joint EGFP expression decreased amount, abnormal	irx7^el538/el538; trps1^j1271aGt; el10Tg	standard conditions	Fig. 3 from Askary et al., 2015
opercle decreased size, abnormal	emx2^el586/el586; irx5a^el574/el574; irx7^el538/el538	standard conditions	Fig. 6 from Askary et al., 2017
symplectic decreased length, abnormal	emx2^el586/el586; irx5a^el574/el574; irx7^el538/el538	standard conditions	Fig. 6 from Askary et al., 2017
interhyal-hyosymplectic joint malformed, abnormal	emx2^el586/el586; irx5a^el574/el574; irx7^el538/el538	standard conditions	Fig. 6 from Askary et al., 2017
cranial neural crest cell sox10 expression decreased amount, abnormal	irx1b^el833/el833; irx7^el540/el540; irx4b^el834/el834	standard conditions	Fig. 4 from Farmer et al., 2021
pharyngeal arch 3-7 cranial neural crest cell decreased amount, abnormal	irx1b^el833/el833; irx7^el540/el540; irx4b^el834/el834	standard conditions	Fig. 4 from Farmer et al., 2021
neural crest cell dlx2a expression decreased amount, abnormal	irx1b^el833/el833; irx7^el540/el540; irx4b^el834/el834	standard conditions	Fig. 4 from Farmer et al., 2021
pharyngeal arch 2 cranial neural crest cell decreased amount, abnormal	irx1b^el833/el833; irx7^el540/el540; irx4b^el834/el834; el10Tg	standard conditions	Fig. 3 from Farmer et al., 2021
pharyngeal arch 1 cranial neural crest cell absent, abnormal	irx1b^el833/el833; irx7^el540/el540; irx4b^el834/el834; el10Tg	standard conditions	Fig. 3 from Farmer et al., 2021
palatoquadrate cartilage absent, abnormal	irx1b^el833/el833; irx7^el540/el540; irx1a^el830/+; irx2a^el831/+; irx4a^el832/+; irx4b^el834/el834	standard conditions	Fig. 3 from Farmer et al., 2021
Meckel's cartilage absent, abnormal	irx1b^el833/el833; irx7^el540/el540; irx1a^el830/+; irx2a^el831/+; irx4a^el832/+; irx4b^el834/el834	standard conditions	Fig. 3 from Farmer et al., 2021
Meckel's cartilage fused with ceratohyal bone, abnormal	irx3a^el835/el835; irx3b^el837/el837; irx5a^el576/el576; irx5b^el722/el722; irx6a^el836/el836; irx7^el540/el540	standard conditions	Fig. 7 from Farmer et al., 2021
palatoquadrate cartilage absent, abnormal	irx1b^el833/el833; irx3a^el835/el835; irx3b^el837/el837; irx5a^el576/el576; irx5b^el722/el722; irx6a^el836/el836; irx7^el540/el540; irx1a^el830/+; irx2a^el831/+; irx4a^el832/+; irx4b^el834/el834	standard conditions	Fig. 3 from Farmer et al., 2021
ceratohyal cartilage decreased size, abnormal	irx1b^el833/el833; irx3a^el835/el835; irx3b^el837/el837; irx5a^el576/el576; irx5b^el722/el722; irx6a^el836/el836; irx7^el540/el540; irx1a^el830/+; irx2a^el831/+; irx4a^el832/+; irx4b^el834/el834	standard conditions	Fig. 3 from Farmer et al., 2021
Meckel's cartilage absent, abnormal	irx1b^el833/el833; irx3a^el835/el835; irx3b^el837/el837; irx5a^el576/el576; irx5b^el722/el722; irx6a^el836/el836; irx7^el540/el540; irx1a^el830/+; irx2a^el831/+; irx4a^el832/+; irx4b^el834/el834	standard conditions	Fig. 3 from Farmer et al., 2021
neurocranium absent, abnormal	irx1b^el833/el833; irx3a^el835/el835; irx3b^el837/el837; irx5a^el576/el576; irx5b^el722/el722; irx6a^el836/el836; irx7^el540/el540; irx1a^el830/+; irx2a^el831/+; irx4a^el832/+; irx4b^el834/el834	standard conditions	Fig. 3 from Farmer et al., 2021
ceratobranchial cartilage absent, abnormal	irx1b^el833/el833; irx3a^el835/el835; irx3b^el837/el837; irx5a^el576/el576; irx5b^el722/el722; irx6a^el836/el836; irx7^el540/el540; irx1a^el830/+; irx2a^el831/+; irx4a^el832/+; irx4b^el834/el834	standard conditions	Fig. 3 from Farmer et al., 2021

Citations