Morpholino

MO4-thraa

ID
ZDB-MRPHLNO-160429-5
Name
MO4-thraa
Previous Names
None
Target
Sequence
5' - ATGTCTTCTGGCTGAAAGAC - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Splice-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO4-thraa
Expressed Gene Anatomy Figures
dio1 Fig. 8 with image from Marelli et al., 2016
dio2 Fig. 8 with image from Marelli et al., 2016
dio3a Fig. 8 with image from Marelli et al., 2016
dio3b Fig. 8 with image from Marelli et al., 2016
slc5a5 Fig. 6 with image from Marelli et al., 2016
tg Fig. 6 with image from Marelli et al., 2016
tshba Fig. 6 with image from Marelli et al., 2016
Phenotype
Phenotype resulting from MO4-thraa
Phenotype Fish Figures
brain dio3a expression decreased amount, abnormal AB + MO4-thraa Fig. 8 with image from Marelli et al., 2016
embryo development decreased rate, abnormal AB + MO4-thraa Fig. S4 with image from Marelli et al., 2016
head decreased size, abnormal AB + MO4-thraa Fig. 3 with image,  Fig. 5 with image from Marelli et al., 2016
hypophysis dio2 expression increased amount, abnormal AB + MO4-thraa Fig. 8 with image from Marelli et al., 2016
hypophysis dio2 expression increased distribution, abnormal AB + MO4-thraa Fig. 8 with image from Marelli et al., 2016
hypophysis cell decreased volume, abnormal AB + MO4-thraa Fig. 6 with image from Marelli et al., 2016
mandibular arch skeleton has fewer parts of type cartilage element, abnormal AB + MO4-thraa Fig. S5 with image from Marelli et al., 2016
pericardium edematous, abnormal AB + MO4-thraa Fig. 3 with image,  Fig. 5 with image from Marelli et al., 2016
pronephric duct dio3b expression decreased amount, abnormal AB + MO4-thraa Fig. 8 with image from Marelli et al., 2016
pronephric duct proximal region dio3b expression absent, abnormal AB + MO4-thraa Fig. 8 with image from Marelli et al., 2016
pronephric duct proximal region dio3a expression absent, abnormal AB + MO4-thraa Fig. 8 with image from Marelli et al., 2016
swim bladder uninflated, abnormal AB + MO4-thraa Fig. S5 with image from Marelli et al., 2016
thyroid follicle slc5a5 expression decreased amount, abnormal AB + MO4-thraa Fig. 6 with image from Marelli et al., 2016
thyroid follicle tg expression decreased amount, abnormal AB + MO4-thraa Fig. 6 with image from Marelli et al., 2016
thyroid follicle ab-t4 labeling decreased distribution, abnormal AB + MO4-thraa Fig. 7 with image from Marelli et al., 2016
thyroid follicle cell decreased volume, abnormal AB + MO4-thraa Fig. 6 with image from Marelli et al., 2016
ventricular system edematous, abnormal AB + MO4-thraa Fig. 3 with image,  Fig. 5 with image from Marelli et al., 2016
ventricular system hydrocephalic, abnormal AB + MO4-thraa Fig. 5 with image from Marelli et al., 2016
whole organism dead, abnormal AB + MO4-thraa Fig. S5 with image from Marelli et al., 2016
whole organism dio3a expression decreased amount, abnormal AB + MO4-thraa Fig. 8 with image from Marelli et al., 2016
whole organism dio3b expression decreased amount, abnormal AB + MO4-thraa Fig. 8 with image from Marelli et al., 2016
whole organism decreased length, abnormal AB + MO4-thraa Fig. 3 with image,  Fig. S4 with image from Marelli et al., 2016
whole organism decreased pigmentation, abnormal AB + MO4-thraa Fig. 3 with image from Marelli et al., 2016
whole organism has fewer parts of type thyroid follicle, abnormal AB + MO4-thraa Fig. 7 with image from Marelli et al., 2016
whole organism dio2 expression increased amount, abnormal AB + MO4-thraa Fig. 8 with image from Marelli et al., 2016
whole organism lacks parts or has fewer parts of type pectoral fin, abnormal AB + MO4-thraa Fig. S5 with image from Marelli et al., 2016
Phenotype of all Fish created by or utilizing MO4-thraa
Phenotype Fish Conditions Figures
mandibular arch skeleton has fewer parts of type cartilage element, abnormal AB + MO4-thraa standard conditions Fig. S5 with image from Marelli et al., 2016
ventricular system edematous, abnormal AB + MO4-thraa standard conditions Fig. 3 with image,  Fig. 5 with image from Marelli et al., 2016
pronephric duct dio3b expression decreased amount, abnormal AB + MO4-thraa standard conditions Fig. 8 with image from Marelli et al., 2016
thyroid follicle cell decreased volume, abnormal AB + MO4-thraa standard conditions Fig. 6 with image from Marelli et al., 2016
embryo development decreased rate, abnormal AB + MO4-thraa standard conditions Fig. S4 with image from Marelli et al., 2016
ventricular system hydrocephalic, abnormal AB + MO4-thraa standard conditions Fig. 5 with image from Marelli et al., 2016
hypophysis dio2 expression increased distribution, abnormal AB + MO4-thraa standard conditions Fig. 8 with image from Marelli et al., 2016
thyroid follicle tg expression decreased amount, abnormal AB + MO4-thraa standard conditions Fig. 6 with image from Marelli et al., 2016
whole organism decreased length, abnormal AB + MO4-thraa standard conditions Fig. 3 with image,  Fig. S4 with image from Marelli et al., 2016
hypophysis dio2 expression increased amount, abnormal AB + MO4-thraa standard conditions Fig. 8 with image from Marelli et al., 2016
whole organism dio3a expression decreased amount, abnormal AB + MO4-thraa standard conditions Fig. 8 with image from Marelli et al., 2016
whole organism dead, abnormal AB + MO4-thraa standard conditions Fig. S5 with image from Marelli et al., 2016
thyroid follicle ab-t4 labeling decreased distribution, abnormal AB + MO4-thraa standard conditions Fig. 7 with image from Marelli et al., 2016
brain dio3a expression decreased amount, abnormal AB + MO4-thraa standard conditions Fig. 8 with image from Marelli et al., 2016
swim bladder uninflated, abnormal AB + MO4-thraa standard conditions Fig. S5 with image from Marelli et al., 2016
thyroid follicle slc5a5 expression decreased amount, abnormal AB + MO4-thraa standard conditions Fig. 6 with image from Marelli et al., 2016
pronephric duct proximal region dio3b expression absent, abnormal AB + MO4-thraa standard conditions Fig. 8 with image from Marelli et al., 2016
whole organism dio3b expression decreased amount, abnormal AB + MO4-thraa standard conditions Fig. 8 with image from Marelli et al., 2016
whole organism lacks parts or has fewer parts of type pectoral fin, abnormal AB + MO4-thraa standard conditions Fig. S5 with image from Marelli et al., 2016
hypophysis cell decreased volume, abnormal AB + MO4-thraa standard conditions Fig. 6 with image from Marelli et al., 2016
whole organism decreased pigmentation, abnormal AB + MO4-thraa standard conditions Fig. 3 with image from Marelli et al., 2016
whole organism dio2 expression increased amount, abnormal AB + MO4-thraa standard conditions Fig. 8 with image from Marelli et al., 2016
whole organism has fewer parts of type thyroid follicle, abnormal AB + MO4-thraa standard conditions Fig. 7 with image from Marelli et al., 2016
pronephric duct proximal region dio3a expression absent, abnormal AB + MO4-thraa standard conditions Fig. 8 with image from Marelli et al., 2016
pericardium edematous, abnormal AB + MO4-thraa standard conditions Fig. 3 with image,  Fig. 5 with image from Marelli et al., 2016
head decreased size, abnormal AB + MO4-thraa standard conditions Fig. 3 with image,  Fig. 5 with image from Marelli et al., 2016
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.