Morpholino
MO1-rac2
- ID
- ZDB-MRPHLNO-111103-1
- Name
- MO1-rac2
- Previous Names
- None
- Target
- Sequence
-
5' - CCACCACACACTTTATTGCTTGCAT - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
Translation-blocking MO.
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-rac2
No data available
Phenotype
Phenotype resulting from MO1-rac2
Phenotype | Fish | Figures |
---|---|---|
neutrophil spatial pattern, abnormal | WT + MO1-rac2 |
Fig. 4 ![]() |
neutrophil homeostasis disrupted, abnormal | WT + MO1-rac2 |
Fig. 4 ![]() |
1 - 2 of 2
Phenotype of all Fish created by or utilizing MO1-rac2
1 - 5 of 30 Show all
Citations
- Tanner, C.D., Rosowski, E.E. (2024) Macrophages inhibit extracellular hyphal growth of A. fumigatus through Rac2 GTPase signaling. Infection and Immunity. 92(2):e0038023
- Lu, X., Zhang, Y., Liu, F., Wang, L. (2020) Rac2 Regulates the Migration of T Lymphoid Progenitors to the Thymus during Zebrafish Embryogenesis. Journal of immunology (Baltimore, Md. : 1950). 204(9):2447-2454
- Zhou, W., Pal, A.S., Hsu, A.Y., Gurol, T., Zhu, X., Wirbisky-Hershberger, S.E., Freeman, J.L., Kasinski, A.L., Deng, Q. (2018) MicroRNA-223 Suppresses the Canonical NF-κB Pathway in Basal Keratinocytes to Dampen Neutrophilic Inflammation. Cell Reports. 22:1810-1823
- Knox, B.P., Deng, Q., Rood, M., Eickhoff, J.C., Keller, N.P., Huttenlocher, A. (2014) Distinct Innate Immune Phagocyte Responses to Aspergillus fumigatus Conidia and Hyphae in Zebrafish Larvae. Eukaryotic Cell. 13(10):1266-77
- Yoo, S.K., Lam, P.Y., Eichelberg, M.R., Zasadil, L., Bement, W.M., and Huttenlocher, A. (2012) The role of microtubules in neutrophil polarity and migration in live zebrafish. Journal of Cell Science. 125(23):5702-5710
- Deng, Q., Yoo, S.K., Cavnar, P.J., Green, J.M., and Huttenlocher, A. (2011) Dual roles for Rac2 in neutrophil motility and active retention in zebrafish hematopoietic tissue. Developmental Cell. 21(4):735-745
1 - 6 of 6
Show