Morpholino

MO1-rac2

ID
ZDB-MRPHLNO-111103-1
Name
MO1-rac2
Previous Names
None
Target
Sequence
5' - CCACCACACACTTTATTGCTTGCAT - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Translation-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-rac2
No data available
Phenotype
Phenotype resulting from MO1-rac2
Phenotype of all Fish created by or utilizing MO1-rac2
Phenotype Fish Conditions Figures
defense response to Gram-negative bacterium disrupted, abnormal WT + MO1-rac2 bacterial treatment by injection: Pseudomonas aeruginosa Fig. 2 with image from Deng et al., 2011
neutrophil mediated immunity disrupted, abnormal WT + MO1-rac2 bacterial treatment by injection: Pseudomonas aeruginosa Fig. 2 with image from Deng et al., 2011
neutrophil chemotaxis disrupted, abnormal WT + MO1-rac2 physical alteration: caudal fin Fig. 1 with image from Deng et al., 2011
neutrophil spatial pattern, abnormal WT + MO1-rac2 standard conditions Fig. 4 with image from Deng et al., 2011
neutrophil homeostasis disrupted, abnormal WT + MO1-rac2 standard conditions Fig. 4 with image from Deng et al., 2011
neutrophil chemotaxis disrupted, abnormal WT + MO1-rac2 bacterial treatment by injection: Pseudomonas aeruginosa Fig. 2 with image from Deng et al., 2011
neutrophil mediated immunity disrupted, abnormal WT + MO1-rac2 physical alteration: caudal fin Fig. 1 with image from Deng et al., 2011
response to wounding disrupted, abnormal WT + MO1-rac2 physical alteration: caudal fin Fig. 1 with image from Deng et al., 2011
thymus primordium leukocyte coro1a expression decreased amount, abnormal WT + MO1-rac2 + MO2-rac2 standard conditions Fig. 4 from Lu et al., 2020
thymus lcp1 expression decreased amount, abnormal WT + MO1-rac2 + MO2-rac2 standard conditions Fig. 4 from Lu et al., 2020
caudal hematopoietic tissue pro-T cell myb expression increased amount, abnormal WT + MO1-rac2 + MO2-rac2 standard conditions Fig. 4 from Lu et al., 2020
thymus leukocyte coro1a expression decreased amount, abnormal WT + MO1-rac2 + MO2-rac2 standard conditions Fig. 4 from Lu et al., 2020
thymus T cell rag1 expression decreased amount, abnormal WT + MO1-rac2 + MO2-rac2 standard conditions Fig. 2 from Lu et al., 2020
thymus T cell ccr9a expression decreased amount, abnormal WT + MO1-rac2 + MO2-rac2 standard conditions Fig. 2 from Lu et al., 2020
caudal hematopoietic tissue leukocyte lcp1 expression increased amount, abnormal WT + MO1-rac2 + MO2-rac2 standard conditions Fig. 4 from Lu et al., 2020
thymus T cell ccr9b expression decreased amount, abnormal WT + MO1-rac2 + MO2-rac2 standard conditions Fig. 2 from Lu et al., 2020
caudal hematopoietic tissue leukocyte coro1a expression increased amount, abnormal WT + MO1-rac2 + MO2-rac2 standard conditions Fig. 4 from Lu et al., 2020
leukocyte migration disrupted, abnormal WT + MO1-rac2 + MO2-rac2 standard conditions Fig. 4 from Lu et al., 2020
caudal hematopoietic tissue pro-T cell irf4a expression increased amount, abnormal WT + MO1-rac2 + MO2-rac2 standard conditions Fig. 4 from Lu et al., 2020
thymus T cell lck expression decreased amount, abnormal WT + MO1-rac2 + MO2-rac2 standard conditions Fig. 2 from Lu et al., 2020
caudal hematopoietic tissue pro-T cell ccr9a expression increased amount, abnormal WT + MO1-rac2 + MO2-rac2 standard conditions Fig. 4 from Lu et al., 2020
thymus leukocyte lcp1 expression decreased amount, abnormal WT + MO1-rac2 + MO2-rac2 standard conditions Fig. 4 from Lu et al., 2020
pro-T cell cell migration disrupted, abnormal WT + MO1-rac2 + MO2-rac2 standard conditions Fig. 4 from Lu et al., 2020
caudal hematopoietic tissue pro-T cell mislocalised, abnormal WT + MO1-rac2 + MO2-rac2 standard conditions Fig. 4 from Lu et al., 2020
caudal hematopoietic tissue leukocyte mislocalised, abnormal WT + MO1-rac2 + MO2-rac2 standard conditions Fig. 4 from Lu et al., 2020
thymus T cell decreased amount, abnormal hkz04tTg + MO1-rac2 + MO2-rac2 standard conditions Fig. 2 from Lu et al., 2020
thymus T cell decreased amount, abnormal zf411Tg + MO1-rac2 + MO2-rac2 standard conditions Fig. 2 from Lu et al., 2020
caudal fin I-kappaB kinase/NF-kappaB signaling process quality, ameliorated mir223pu18/pu18; nc1Tg + MO1-rac2 + MO1-spi1b transection: caudal fin Fig. 4 with image from Zhou et al., 2018
caudal fin EGFP expression amount, ameliorated mir223pu18/pu18; nc1Tg + MO1-rac2 + MO1-spi1b transection: caudal fin Fig. 4 with image from Zhou et al., 2018
Citations