Morpholino
MO4-tnfa
- ID
- ZDB-MRPHLNO-110621-1
- Name
- MO4-tnfa
- Previous Names
- None
- Target
- Sequence
-
5' - GCAGGATTTTCACCTTATGGAGCGT - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
Splice-blocking MO.
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO4-tnfa
No data available
Phenotype
Phenotype resulting from MO4-tnfa
1 - 5 of 10 Show all
Phenotype of all Fish created by or utilizing MO4-tnfa
1 - 5 of 24 Show all
Citations
- Tie, R., Li, H., Cai, S., Liang, Z., Shan, W., Wang, B., Tan, Y., Zheng, W., Huang, H. (2019) Interleukin-6 signaling regulates hematopoietic stem cell emergence. Experimental & molecular medicine. 51:1-12
- Hall, C.J., Sanderson, L.E., Lawrence, L.M., Pool, B., van der Kroef, M., Ashimbayeva, E., Britto, D., Harper, J.L., Lieschke, G.J., Astin, J.W., Crosier, K.E., Dalbeth, N., Crosier, P.S. (2018) Blocking fatty acid-fueled mROS production within macrophages alleviates acute gouty inflammation. The Journal of Clinical Investigation. 128(5):1752-1771
- Smith, C.J., Wheeler, M.A., Marjoram, L., Bagnat, M., Deppmann, C.D., Kucenas, S. (2017) TNFa/TNFR2 signaling is required for glial ensheathment at the dorsal root entry zone. PLoS Genetics. 13:e1006712
- van der Vaart, M., Svoboda, O., Weijts, B.G., Espín-Palazón, R., Sapp, V., Pietri, T., Bagnat, M., Muotri, A.R., Traver, D. (2017) Mecp2 regulates tnfa during zebrafish embryonic development and acute inflammation.. Disease models & mechanisms. 10(12):1439-1451
- Espín-Palazón, R., Martínez-López, A., Roca, F.J., López-Muñoz, A., Tyrkalska, S.D., Candel, S., García-Moreno, D., Falco, A., Meseguer, J., Estepa, A., Mulero, V. (2016) TNFα Impairs Rhabdoviral Clearance by Inhibiting the Host Autophagic Antiviral Response. PLoS pathogens. 12:e1005699
- Marjoram, L., Alvers, A., Deerhake, M.E., Bagwell, J., Mankiewicz, J., Cocchiaro, J.L., Beerman, R.W., Willer, J., Sumigray, K.D., Katsanis, N., Tobin, D.M., Rawls, J.F., Goll, M.G., Bagnat, M. (2015) Epigenetic control of intestinal barrier function and inflammation in zebrafish. Proceedings of the National Academy of Sciences of the United States of America. 112(9):2770-5
- Candel, S., de Oliveira, S., López-Muñoz, A., García-Moreno, D., Espín-Palazón, R., Tyrkalska, S.D., Cayuela, M.L., Renshaw, S.A., Corbalán-Vélez, R., Vidal-Abarca, I., Tsai, H.J., Meseguer, J., Sepulcre, M.P., Mulero, V. (2014) Tnfa signaling through tnfr2 protects skin against oxidative stress-induced inflammation. PLoS Biology. 12:e1001855
- Espín-Palazón, R., Stachura, D.L., Campbell, C.A., García-Moreno, D., Del Cid, N., Kim, A.D., Candel, S., Meseguer, J., Mulero, V., Traver, D. (2014) Proinflammatory signaling regulates hematopoietic stem cell emergence. Cell. 159:1070-85
- Tobin, D.M., Roca, F.J., Oh, S.F., McFarland, R., Vickery, T.W., Ray, J.P., Ko, D.C., Zou, Y., Bang, N.D., Chau, T.T., Vary, J.C., Hawn, T.R., Dunstan, S.J., Farrar, J.J., Thwaites, G.E., King, M.C., Serhan, C.N., and Ramakrishnan, L. (2012) Host genotype-specific therapies can optimize the inflammatory response to mycobacterial infections. Cell. 148(3):434-446
- López-Muñoz, A., Sepulcre, M.P., Roca, F.J., Figueras, A., Meseguer, J., and Mulero, V. (2011) Evolutionary conserved pro-inflammatory and antigen presentation functions of zebrafish IFNγ revealed by transcriptomic and functional analysis. Molecular immunology. 48(9-10):1073-1083
1 - 10 of 10
Show