Morpholino
MO1-prnpb
- ID
- ZDB-MRPHLNO-100423-4
- Name
- MO1-prnpb
- Previous Names
-
- prp1-1 MO (1)
- Target
- Sequence
-
5' - TCTCTCCCGCAGCACTCTCTGCTCA - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
Targets the 5'UTR.
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-prnpb
No data available
Phenotype
Phenotype resulting from MO1-prnpb
1 - 5 of 17 Show all
Phenotype of all Fish created by or utilizing MO1-prnpb
1 - 5 of 38 Show all
Citations
- Pollock, N.M., Leighton, P., Neil, G., Allison, W.T. (2021) Transcriptomic analysis of zebrafish prion protein mutants supports conserved cross-species function of the cellular prion protein. Prion. 15:70-81
- Sempou, E., Biasini, E., Pinzón-Olejua, A., Harris, D.A., Málaga-Trillo, E. (2016) Activation of zebrafish Src family kinases by the prion protein is an amyloid-β-sensitive signal that prevents the endocytosis and degradation of E-cadherin/β-catenin complexes in vivo. Molecular neurodegeneration. 11:18
- Kaiser, D.M., Acharya, M., Leighton, P.L., Wang, H., Daude, N., Wohlgemuth, S., Shi, B., and Allison, W.T. (2012) Amyloid Beta precursor protein and prion protein have a conserved interaction affecting cell adhesion and CNS development. PLoS One. 7(12):e51305
- Málaga-Trillo, E., Solis, G.P., Schrock, Y., Geiss, C., Luncz, L., Thomanetz, V., and Stuermer, C.A. (2009) Regulation of Embryonic Cell Adhesion by the Prion Protein. PLoS Biology. 7(3):e55
1 - 4 of 4
Show