Morpholino
MO1-llgl1
- ID
- ZDB-MRPHLNO-100419-12
- Name
- MO1-llgl1
- Previous Names
-
- MOlgl1-atg (1)
- Target
- Sequence
-
5' - CCGTCTGAACCTAAACTTCATCATC - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
Translation-blocking MO
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-llgl1
No data available
Phenotype
Phenotype resulting from MO1-llgl1
1 - 5 of 37 Show all
Phenotype of all Fish created by or utilizing MO1-llgl1
1 - 5 of 42 Show all
Citations
- Flinn, M.A., Otten, C., Brandt, Z.J., Bostrom, J.R., Kenarsary, A., Wan, T.C., Auchampach, J.A., Abdelilah-Seyfried, S., O'Meara, C.C., Link, B.A. (2020) Llgl1 regulates zebrafish cardiac development by mediating Yap stability in cardiomyocytes. Development (Cambridge, England). 147(16):
- Magre, I., Fandade, V., Damle, I., Banerjee, P., Yadav, S.K., Sonawane, M., Joseph, J. (2019) Nup358 regulates microridge length by controlling SUMOylation-dependent activity of aPKC in zebrafish epidermis. Journal of Cell Science. 132(12):
- Raman, R., Damle, I., Rote, R., Banerjee, S., Dingare, C., Sonawane, M. (2016) aPKC regulates apical localization of Lgl to restrict elongation of microridges in developing zebrafish epidermis. Nature communications. 7:11643
- Clark, B.S., Cui, S., Miesfeld, J.B., Klezovitch, O., Vasioukhin, V., and Link, B.A. (2012) Loss of Llgl1 in retinal neuroepithelia reveals links between apical domain size, Notch activity and neurogenesis. Development (Cambridge, England). 139(9):1599-1610
- Hava, D., Forster, U., Matsuda, M., Cui, S., Link, B.A., Eichhorst, J., Wiesner, B., Chitnis, A., and Abdelilah-Seyfried, S. (2009) Apical membrane maturation and cellular rosette formation during morphogenesis of the zebrafish lateral line. Journal of Cell Science. 122(Pt 5):687-695
1 - 5 of 5
Show