Morpholino

MO1-c1ql4l

ID

ZDB-MRPHLNO-081119-1

Name

MO1-c1ql4l

Previous Names

None

Target

Sequence

5' - CAGTACGATTTGTAACACCGCCATC - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO1-c1ql4l

Expressed Gene	Anatomy	Figures
baxa	whole organism	Fig. 6 from Mei et al., 2008
c1ql4l	(not) whole organism	Fig. 3 from Mei et al., 2008
casp3a	whole organism	Fig. 6 from Mei et al., 2008
cdkn1a	whole organism	Fig. 6 from Mei et al., 2008
egr2b	rhombomere 3 rhombomere 5	Fig. S4 from Mei et al., 2008
epha4a	rhombomere 3 rhombomere 5	Fig. S4 from Mei et al., 2008
fgf8a	midbrain hindbrain boundary	Fig. S4 from Mei et al., 2008
gata1a	intermediate cell mass of mesoderm	Fig. 7 from Mei et al., 2008
hbae1.1	intermediate cell mass of mesoderm	Fig. 7 from Mei et al., 2008
her5	midbrain hindbrain boundary	Fig. S4 from Mei et al., 2008
mdm2	whole organism	Fig. 6 from Mei et al., 2008
pax2a	midbrain hindbrain boundary	Fig. S4 from Mei et al., 2008
tal1	intermediate cell mass of mesoderm	Fig. 7 from Mei et al., 2008
tp53	whole organism	Fig. 6 from Mei et al., 2008

Phenotype

Phenotype resulting from MO1-c1ql4l

Phenotype	Fish	Figures
brain cell apoptotic, abnormal	WT + MO1-c1ql4l	Fig. 3 , Fig. 4 from Mei et al., 2008
cell cycle disrupted, abnormal	WT + MO1-c1ql4l	Fig. 6 from Mei et al., 2008
cell cycle rate, abnormal	WT + MO1-c1ql4l + MO4-tp53	Fig. 6 from Mei et al., 2008
ceratobranchial cartilage aplastic, abnormal	WT + MO1-c1ql4l	Fig. 3 from Mei et al., 2008
ceratohyal cartilage decreased length, abnormal	WT + MO1-c1ql4l	Fig. 3 from Mei et al., 2008
cranial vasculature structure, abnormal	zf528Tg + MO1-c1ql4l	Fig. 8 from Mei et al., 2008
defense response to bacterium disrupted, abnormal	WT + MO1-c1ql4l	Fig. 9 from Mei et al., 2008
embryonic viscerocranium morphogenesis disrupted, abnormal	WT + MO1-c1ql4l	Fig. 3 from Mei et al., 2008
intermediate cell mass of mesoderm apoptotic, abnormal	WT + MO1-c1ql4l	Fig. 4 from Mei et al., 2008
mesencephalic vein malformed, abnormal	zf528Tg + MO1-c1ql4l	Fig. 8 from Mei et al., 2008
midbrain hindbrain boundary malformed, abnormal	WT + MO1-c1ql4l	Fig. 3 from Mei et al., 2008
nucleate erythrocyte hemoglobin complex decreased amount, abnormal	WT + MO1-c1ql4l	Fig. 8 from Mei et al., 2008
primitive hemopoiesis disrupted, abnormal	WT + MO1-c1ql4l	Fig. 7 from Mei et al., 2008

Phenotype of all Fish created by or utilizing MO1-c1ql4l

Phenotype	Fish	Conditions	Figures
brain cell apoptotic, abnormal	WT + MO1-c1ql4l	standard conditions	Fig. 3 , Fig. 4 from Mei et al., 2008
defense response to bacterium disrupted, abnormal	WT + MO1-c1ql4l	standard conditions	Fig. 9 from Mei et al., 2008
cell cycle disrupted, abnormal	WT + MO1-c1ql4l	standard conditions	Fig. 6 from Mei et al., 2008
ceratobranchial cartilage aplastic, abnormal	WT + MO1-c1ql4l	standard conditions	Fig. 3 from Mei et al., 2008
intermediate cell mass of mesoderm apoptotic, abnormal	WT + MO1-c1ql4l	standard conditions	Fig. 4 from Mei et al., 2008
embryonic viscerocranium morphogenesis disrupted, abnormal	WT + MO1-c1ql4l	standard conditions	Fig. 3 from Mei et al., 2008
primitive hemopoiesis disrupted, abnormal	WT + MO1-c1ql4l	standard conditions	Fig. 7 from Mei et al., 2008
ceratohyal cartilage decreased length, abnormal	WT + MO1-c1ql4l	standard conditions	Fig. 3 from Mei et al., 2008
midbrain hindbrain boundary malformed, abnormal	WT + MO1-c1ql4l	standard conditions	Fig. 3 from Mei et al., 2008
nucleate erythrocyte hemoglobin complex decreased amount, abnormal	WT + MO1-c1ql4l	standard conditions	Fig. 8 from Mei et al., 2008
cell cycle rate, abnormal	WT + MO1-c1ql4l + MO4-tp53	standard conditions	Fig. 6 from Mei et al., 2008
mesencephalic vein malformed, abnormal	zf528Tg + MO1-c1ql4l	standard conditions	Fig. 8 from Mei et al., 2008
cranial vasculature structure, abnormal	zf528Tg + MO1-c1ql4l	standard conditions	Fig. 8 from Mei et al., 2008

Citations