Morpholino
MO2-bbs1
- ID
- ZDB-MRPHLNO-081027-1
- Name
- MO2-bbs1
- Previous Names
-
- bbs1_aug (1)
- Target
- Sequence
-
5' - GGGAACAGATGACATGGTTGTTTTG - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
- None
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-bbs1
No data available
Phenotype
Phenotype resulting from MO2-bbs1
1 - 5 of 23 Show all
Phenotype of all Fish created by or utilizing MO2-bbs1
1 - 5 of 47 Show all
Citations
- Kim, Y.H., Epting, D., Slanchev, K., Engel, C., Walz, G., and Kramer-Zucker, A. (2013) A Complex of BBS1 and NPHP7 Is Required for Cilia Motility in Zebrafish. PLoS One. 8(9):e72549
- Loktev, A.V., Zhang, Q., Beck, J.S., Searby, C.C., Scheetz, T.E., Bazan, J.F., Slusarski, D.C., Sheffield, V.C., Jackson, P.K., and Nachury, M.V. (2008) A BBSome Subunit Links Ciliogenesis, Microtubule Stability, and Acetylation. Developmental Cell. 15(6):854-865
- Tayeh, M.K., Yen, H.J., Beck, J.S., Searby, C.C., Westfall, T.A., Griesbach, H., Sheffield, V.C., and Slusarski, D.C. (2008) Genetic interaction between Bardet-Biedl syndrome genes and implications for limb patterning. Human molecular genetics. 17(13):1956-1967
1 - 3 of 3
Show