Morpholino

MO1-wnt11f2

ID
ZDB-MRPHLNO-041217-10
Name
MO1-wnt11f2
Previous Names
  • MO1-wnt11
  • wnt11 MO (1)
  • wnt11MO (1)
Target
Sequence
5' - GAAAGTTCCTGTATTCTGTCATGTC - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-wnt11f2
No data available
Phenotype
Phenotype resulting from MO1-wnt11f2
Phenotype Fish Figures
axis decreased length, abnormal WT + MO1-wnt11f2 Fig. 9 with image,  Fig. S3 with image from Goudevenou et al., 2011
Fig. 6 from Zhu et al., 2006
brain morphology, abnormal WT + MO1-wnt11f2 Fig. 9 with image from Goudevenou et al., 2011
cell migration involved in gastrulation decreased rate, abnormal WT + MO1-wnt11f2 Fig. 6 with image from van Eekelen et al., 2010
cell migration involved in gastrulation disrupted, abnormal WT + MO1-wnt11f2 Fig. 9 with image from Goudevenou et al., 2011
convergent extension disrupted, abnormal WT + MO1-wnt11f2 Fig. 6 from Ferrante et al., 2009
Fig. 2 with image from Lemeer et al., 2007
convergent extension involved in gastrulation disrupted, abnormal WT + MO1-wnt11f2 Fig. 6 with image from Xu et al., 2014
Fig. S3 with image from Goudevenou et al., 2011
Fig. 6 from Zhu et al., 2006
Fig. 1 from Jopling et al., 2005
eye decreased distance eye, abnormal WT + MO1-wnt11f2 Fig. 2 from Macheda et al., 2012
Fig. 9 with image from Goudevenou et al., 2011
eye fused with eye, abnormal WT + MO1-wnt11f2 Fig. S3 with image from Goudevenou et al., 2011
Fig. 7 with image from van Eekelen et al., 2010
Fig. 6 from Zhu et al., 2006
Fig. 1 from Jopling et al., 2005
Fig. 5 with image from Waxman et al., 2004
Fig. 1 from Lele et al., 2001
forebrain structure, abnormal WT + MO1-wnt11f2 Fig. 9 with image from Goudevenou et al., 2011
forebrain anterior region aplastic, abnormal WT + MO1-wnt11f2 Fig. S3 with image from Goudevenou et al., 2011
notochord decreased length, abnormal WT + MO1-wnt11f2 Fig. 6 from Zhu et al., 2006
notochord increased width, abnormal WT + MO1-wnt11f2 Fig. 6 from Zhu et al., 2006
notochord protruding, abnormal WT + MO1-wnt11f2 Fig. 4 with image from Kida et al., 2007
pericardium edematous, abnormal WT + MO1-wnt11f2 Fig. 7 with image from van Eekelen et al., 2010
prechordal plate decreased length, abnormal WT + MO1-wnt11f2 Fig. 6 from Zhu et al., 2006
whole organism decreased length, abnormal WT + MO1-wnt11f2 Fig. 7 with image from van Eekelen et al., 2010
whole organism morphology, abnormal WT + MO1-wnt11f2 Fig. 7 with image from van Eekelen et al., 2010
whole organism anterior-most region increased angle to whole organism posterior-most region, abnormal WT + MO1-wnt11f2 Fig. 6 with image from Xu et al., 2014
whole organism anterior-posterior axis decreased length, abnormal WT + MO1-wnt11f2 Fig. 6 with image from Xu et al., 2014
Fig. 1 from Jopling et al., 2005
whole organism left-right axis increased width, abnormal WT + MO1-wnt11f2 Fig. 1 from Jopling et al., 2005
Phenotype of all Fish created by or utilizing MO1-wnt11f2
Phenotype Fish Conditions Figures
whole organism anterior-posterior axis decreased length, abnormal WT + MO1-wnt11f2 standard conditions Fig. 6 with image from Xu et al., 2014
Fig. 1 from Jopling et al., 2005
whole organism anterior-most region increased angle to whole organism posterior-most region, abnormal WT + MO1-wnt11f2 standard conditions Fig. 6 with image from Xu et al., 2014
eye decreased distance eye, abnormal WT + MO1-wnt11f2 standard conditions Fig. 2 from Macheda et al., 2012
Fig. 9 with image from Goudevenou et al., 2011
brain morphology, abnormal WT + MO1-wnt11f2 standard conditions Fig. 9 with image from Goudevenou et al., 2011
cell migration involved in gastrulation disrupted, abnormal WT + MO1-wnt11f2 standard conditions Fig. 9 with image from Goudevenou et al., 2011
forebrain anterior region aplastic, abnormal WT + MO1-wnt11f2 standard conditions Fig. S3 with image from Goudevenou et al., 2011
convergent extension disrupted, abnormal WT + MO1-wnt11f2 standard conditions Fig. 6 from Ferrante et al., 2009
Fig. 2 with image from Lemeer et al., 2007
axis decreased length, abnormal WT + MO1-wnt11f2 standard conditions Fig. 9 with image,  Fig. S3 with image from Goudevenou et al., 2011
Fig. 6 from Zhu et al., 2006
forebrain structure, abnormal WT + MO1-wnt11f2 standard conditions Fig. 9 with image from Goudevenou et al., 2011
pericardium edematous, abnormal WT + MO1-wnt11f2 standard conditions Fig. 7 with image from van Eekelen et al., 2010
notochord increased width, abnormal WT + MO1-wnt11f2 standard conditions Fig. 6 from Zhu et al., 2006
whole organism morphology, abnormal WT + MO1-wnt11f2 standard conditions Fig. 7 with image from van Eekelen et al., 2010
eye fused with eye, abnormal WT + MO1-wnt11f2 standard conditions Fig. S3 with image from Goudevenou et al., 2011
Fig. 7 with image from van Eekelen et al., 2010
Fig. 6 from Zhu et al., 2006
Fig. 1 from Jopling et al., 2005
Fig. 5 with image from Waxman et al., 2004
Fig. 1 from Lele et al., 2001
notochord decreased length, abnormal WT + MO1-wnt11f2 standard conditions Fig. 6 from Zhu et al., 2006
convergent extension involved in gastrulation disrupted, abnormal WT + MO1-wnt11f2 standard conditions Fig. 6 with image from Xu et al., 2014
Fig. S3 with image from Goudevenou et al., 2011
Fig. 6 from Zhu et al., 2006
Fig. 1 from Jopling et al., 2005
whole organism left-right axis increased width, abnormal WT + MO1-wnt11f2 standard conditions Fig. 1 from Jopling et al., 2005
notochord protruding, abnormal WT + MO1-wnt11f2 standard conditions Fig. 4 with image from Kida et al., 2007
whole organism decreased length, abnormal WT + MO1-wnt11f2 standard conditions Fig. 7 with image from van Eekelen et al., 2010
prechordal plate decreased length, abnormal WT + MO1-wnt11f2 standard conditions Fig. 6 from Zhu et al., 2006
cell migration involved in gastrulation decreased rate, abnormal WT + MO1-wnt11f2 standard conditions Fig. 6 with image from van Eekelen et al., 2010
convergent extension involved in axis elongation disrupted, abnormal TL + MO1-porcn + MO1-wnt11f2 standard conditions Fig. 4 from Chen et al., 2012
eye fused with eye, abnormal WT + MO1-dact2 + MO1-wnt11f2 standard conditions Fig. 5 with image from Waxman et al., 2004
convergent extension involved in axis elongation disrupted, abnormal WT + MO1-dact2 + MO1-wnt11f2 standard conditions Fig. 5 with image from Waxman et al., 2004
convergent extension disrupted, abnormal WT + MO1-ofd1 + MO1-wnt11f2 standard conditions Fig. 6 from Ferrante et al., 2009
whole organism decreased length, abnormal WT + MO1-ptpra + MO1-wnt11f2 standard conditions Fig. 7 with image from van Eekelen et al., 2010
pericardium edematous, abnormal WT + MO1-ptpra + MO1-wnt11f2 standard conditions Fig. 7 with image from van Eekelen et al., 2010
eye fused with eye, abnormal WT + MO1-ptpra + MO1-wnt11f2 standard conditions Fig. 7 with image from van Eekelen et al., 2010
whole organism morphology, abnormal WT + MO1-ptpra + MO1-wnt11f2 standard conditions Fig. 7 with image from van Eekelen et al., 2010
somite increased width, abnormal WT + MO1-wnt11f2 + MO1-wnt5b standard conditions Fig. 1 with image from Moeller et al., 2006
somite condensed, abnormal WT + MO1-wnt11f2 + MO1-wnt5b standard conditions Fig. 1 with image from Moeller et al., 2006
convergent extension involved in axis elongation disrupted, abnormal WT + MO1-wnt11f2 + MO1-wnt5b standard conditions Fig. 1 with image from Moeller et al., 2006
whole organism decreased length, abnormal WT + MO1-wnt11f2 + MO1-wnt5b standard conditions Fig. 1 with image from Moeller et al., 2006
axis decreased length, abnormal WT + MO1-wnt11f2 + MO2-def6a standard conditions Fig. 9 with image from Goudevenou et al., 2011
cell migration involved in gastrulation disrupted, abnormal WT + MO1-wnt11f2 + MO2-def6a standard conditions Fig. 9 with image from Goudevenou et al., 2011
forebrain anterior region aplastic, abnormal WT + MO1-wnt11f2 + MO2-def6a standard conditions Fig. 9 with image from Goudevenou et al., 2011
eye fused with eye, abnormal WT + MO1-wnt11f2 + MO2-def6a standard conditions Fig. 9 with image from Goudevenou et al., 2011
eye fused with eye, abnormal WT + MO1-wnt11f2 + MO3-ryk standard conditions Fig. 2 from Macheda et al., 2012
whole organism decreased length, abnormal WT + MO1-wnt11f2 + MO3-ryk standard conditions Fig. 2 from Macheda et al., 2012
whole organism decreased length, abnormal WT + MO1-wnt11f2 + MO4-ryk standard conditions Fig. 2 from Macheda et al., 2012
eye fused with eye, abnormal WT + MO1-wnt11f2 + MO4-ryk standard conditions Fig. 2 from Macheda et al., 2012
whole organism morphology, abnormal WT + MO1-ptprea + MO1-ptpreb + MO1-wnt11f2 standard conditions Fig. 7 with image from van Eekelen et al., 2010
eye fused with eye, abnormal WT + MO1-ptprea + MO1-ptpreb + MO1-wnt11f2 standard conditions Fig. 7 with image from van Eekelen et al., 2010
pericardium edematous, abnormal WT + MO1-ptprea + MO1-ptpreb + MO1-wnt11f2 standard conditions Fig. 7 with image from van Eekelen et al., 2010
whole organism decreased length, abnormal WT + MO1-ptprea + MO1-ptpreb + MO1-wnt11f2 standard conditions Fig. 7 with image from van Eekelen et al., 2010
whole organism anterior-posterior axis decreased length, abnormal WT + MO1-fyna,fynb + MO1-wnt11f2 + MO1-yes1 standard conditions Fig. 3 from Jopling et al., 2005
forebrain structure, abnormal WT + MO1-fyna,fynb + MO1-wnt11f2 + MO1-yes1 standard conditions Fig. 3 from Jopling et al., 2005
eye fused with eye, abnormal WT + MO1-fyna,fynb + MO1-wnt11f2 + MO1-yes1 standard conditions Fig. 3 from Jopling et al., 2005
Citations