Morpholino
MO1-wnt11f2
- ID
- ZDB-MRPHLNO-041217-10
- Name
- MO1-wnt11f2
- Previous Names
- Target
- Sequence
-
5' - GAAAGTTCCTGTATTCTGTCATGTC - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
- None
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-wnt11f2
No data available
Phenotype
Phenotype resulting from MO1-wnt11f2
1 - 5 of 20 Show all
Phenotype of all Fish created by or utilizing MO1-wnt11f2
1 - 5 of 47 Show all
Citations
- McLeod, J.J., Rothschild, S.C., Francescatto, L., Kim, H., Tombes, R.M. (2023) Specific CaMKIIs mediate convergent extension cell movements in early zebrafish development. Developmental Dynamics : an official publication of the American Association of Anatomists. 253(4):390-403
- Smutny, M., Ákos, Z., Grigolon, S., Shamipour, S., Ruprecht, V., Čapek, D., Behrndt, M., Papusheva, E., Tada, M., Hof, B., Vicsek, T., Salbreux, G., Heisenberg, C.P. (2017) Friction forces position the neural anlage. Nature cell biology. 19(4):306-317
- Fang, X., Zhang, B., Thisse, B., Bloom, G.S., Thisse, C. (2015) IQGAP3 Is Essential for Cell Proliferation and Motility During Zebrafish Embryonic Development. Cytoskeleton (Hoboken, N.J.). 72(8):422-33
- Wu, B.T., Wen, S.H., Hwang, S.P., Huang, C.J., Kuan, Y.S. (2015) Control of Wnt5b secretion by wntless modulates chondrogenic cell proliferation through fine-tuning fgf3 expression. Journal of Cell Science. 128(12):2328-39
- Xu, X., Shuen, W.H., Chen, C., Goudevenou, K., Jones, P., and Sablitzky, F. (2014) Swap70b is required for convergent and extension cell movement during zebrafish gastrulation linking Wnt11 signalling and RhoA effector function. Developmental Biology. 386(1):191-203
- Chen, Q., Takada, R., and Takada, S. (2012) Loss of Porcupine impairs convergent extension during gastrulation in zebrafish. Journal of Cell Science. 125(9):2224-2234
- Macheda, M.L., Sun, W.W., Kugathasan, K., Hogan, B.M., Bower, N.I., Halford, M.M., Zhang, Y.F., Jacques, B.E., Lieschke, G.J., Dabdoub, A., and Stacker, S.A. (2012) The Wnt Receptor Ryk Plays a Role in Mammalian Planar Cell Polarity Signaling. The Journal of biological chemistry. 287(35):29312-29323
- Clements, W.K., Kim, A.D., Ong, K.G., Moore, J.C., Lawson, N.D., and Traver, D. (2011) A somitic Wnt16/Notch pathway specifies haematopoietic stem cells. Nature. 474(7350):220-224
- Fischer, S., Filipek-Gorniok, B., and Ledin, J. (2011) Zebrafish Ext2 is necessary for Fgf and Wnt signaling, but not for Hh signaling. BMC Developmental Biology. 11(1):53
- Goudevenou, K., Martin, P., Yeh, Y.J., Jones, P., and Sablitzky, F. (2011) Def6 Is Required for Convergent Extension Movements during Zebrafish Gastrulation Downstream of Wnt5b Signaling. PLoS One. 6(10):e26548
1 - 10 of 23
Show