FIGURE
Figure 2
- ID
- ZDB-FIG-220131-312
- Publication
- Gong et al., 2021 - Establishment of a Dihydrofolate Reductase Gene Knock-In Zebrafish Strain to Aid Preliminary Analysis of Congenital Heart Disease Mechanisms
- Other Figures
- All Figure Page
- Back to All Figure Page
Figure 2
|
Design of guide RNA and identification primer. (A) Guide #5 TGATGCAATGGTCAGAGATGTGG; (B) the sequencing result of the activity verification; (C) the optimized amino acid sequence alignment (the lowercase font is the optimized base). |
Expression Data
Expression Detail
Antibody Labeling
Phenotype Data
Phenotype Detail
Acknowledgments
This image is the copyrighted work of the attributed author or publisher, and
ZFIN has permission only to display this image to its users.
Additional permissions should be obtained from the applicable author or publisher of the image.
Full text @ Front Cardiovasc Med