FIGURE SUMMARY
Title

Establishment of a Dihydrofolate Reductase Gene Knock-In Zebrafish Strain to Aid Preliminary Analysis of Congenital Heart Disease Mechanisms

Authors
Gong, K., Xie, T., Yang, Y., Luo, Y., Deng, Y., Chen, K., Tan, Z., Guo, H., Xie, L.
Source
Full text @ Front Cardiovasc Med
Figure 1

Flow chart of the experiment.
Figure 2

Design of guide RNA and identification primer. (A) Guide #5 TGATGCAATGGTCAGAGATGTGG; (B) the sequencing result of the activity verification; (C) the optimized amino acid sequence alignment (the lowercase font is the optimized base).
Figure 3

PCR electrophoresis diagram. (A) screening and genotype identification of F1 generation zebrafish; (B) identification of positive expressions of genotypes in zebrafish; (C) self-progeny genotype identification of F1 generation heterozygous zebrafish.
Figure 4

F2 generation zebrafish KI homozygotes at 6 dpf. (A,C,E,F) F1 heterozygous self-progeny. (B,D,G,H) self-progeny of TU.
Figure 5

Sanger sequencing and sequence alignment analysis results. (A) Sanger sequencing results; (B) design sequence and sequencing alignment results.
Figure 6

The phenotype of the hybrid offspring of the TgG fluorescent line. (A–F) TgG homozygous fluorescent strain dhfr. (G–L) TgG fluorescent strain TU.
Figure 7

Results of pathology, western blot, and hybridization experiments. (A) TU zebrafish; (B) F1 dhfr heterozygous self-progeny (the red arrow points to the heart area). (C,D) WT, dhfr KI heterozygote, and dhfr KI homozygous DHFR protein expression analysis (GAPDH was used as an internal control). E: impaired fertility in zebrafish knocked in by dhfr (*P < 0.05, ***P < 0.001, ****P < 0.0001).
Acknowledgments
This image is the copyrighted work of the attributed author or publisher, and ZFIN has permission only to display this image to its users. Additional permissions should be obtained from the applicable author or publisher of the image. Full text @ Front Cardiovasc Med
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.