Image
|
Figure Caption
Figure 2
Design of guide RNA and identification primer. (A) Guide #5 TGATGCAATGGTCAGAGATGTGG; (B) the sequencing result of the activity verification; (C) the optimized amino acid sequence alignment (the lowercase font is the optimized base).
Acknowledgments
This image is the copyrighted work of the attributed author or publisher, and
ZFIN has permission only to display this image to its users.
Additional permissions should be obtained from the applicable author or publisher of the image.
Full text @ Front Cardiovasc Med