CRISPR

CRISPR1-psap

ID

ZDB-CRISPR-240716-8

Name

CRISPR1-psap

Previous Names

None

Target

psap (1)

Sequence

5' - AGCTGTGGCAAGTCCCCTGT - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Constructs

No data available

Genomic Features

Genomic Feature	Affected Genomic Regions
f28	psap
f29	psap

Expression

Gene expression in Wild Types + CRISPR1-psap

No data available

Phenotype

Phenotype resulting from CRISPR1-psap

No data available

Phenotype of all Fish created by or utilizing CRISPR1-psap

Phenotype	Fish	Conditions	Figures
brain mbpa expression decreased amount, abnormal	psap^f28/f28	standard conditions	Fig. 3. , Fig. 6. , Fig. 7. from Zhang et al., 2023
brain gfap expression increased amount, abnormal	psap^f28/f28	standard conditions	Fig. 6. from Zhang et al., 2023
lipid metabolic process process quality, abnormal	psap^f28/f28	standard conditions	Fig. 2. from Zhang et al., 2023
brain nfkbiaa expression increased amount, abnormal	psap^f28/f28	standard conditions	Fig. 6. , Fig. 7. from Zhang et al., 2023
brain stat3 expression increased amount, abnormal	psap^f28/f28	standard conditions	Fig. 6. from Zhang et al., 2023
brain ptprc expression increased amount, abnormal	psap^f28/f28	standard conditions	Fig. 6. from Zhang et al., 2023
brain il1b expression increased amount, abnormal	psap^f28/f28	chemical treatment by environment: monomethyl fumarate	Fig. 7. from Zhang et al., 2023
locomotion decreased occurrence, abnormal	psap^f28/f28	standard conditions	Fig. 3. from Zhang et al., 2023
brain tnfb expression increased amount, abnormal	psap^f28/f28	standard conditions	Fig. 6. , Fig. 7. from Zhang et al., 2023
brain il1b expression increased amount, abnormal	psap^f28/f28	standard conditions	Fig. 6. , Fig. 7. from Zhang et al., 2023
whole organism decreased length, abnormal	psap^f28/f28	standard conditions	Fig. 3. from Zhang et al., 2023
whole organism decreased life span, abnormal	psap^f28/f28	chemical treatment by environment: monomethyl fumarate	Fig. 7. from Zhang et al., 2023
brain cd68 expression increased amount, abnormal	psap^f28/f28	standard conditions	Fig. 6. , Fig. 7. from Zhang et al., 2023
brain rbfox3a expression decreased amount, abnormal	psap^f28/f28	standard conditions	Fig. 6. from Zhang et al., 2023
swimming decreased linear velocity, abnormal	psap^f28/f28	standard conditions	Fig. 3. from Zhang et al., 2023
brain mbpa expression decreased amount, abnormal	psap^f28/f28	chemical treatment by environment: monomethyl fumarate	Fig. 7. from Zhang et al., 2023
brain socs1b expression increased amount, abnormal	psap^f28/f28	standard conditions	Fig. 6. from Zhang et al., 2023
brain nfkbiaa expression increased amount, abnormal	psap^f28/f28	chemical treatment by environment: monomethyl fumarate	Fig. 7. from Zhang et al., 2023
whole organism decreased life span, abnormal	psap^f28/f28	standard conditions	Fig. 7. from Zhang et al., 2023
cranial nerve II myelination decreased occurrence, abnormal	psap^f28/f28	standard conditions	Fig. 3. from Zhang et al., 2023
brain tnfb expression increased amount, abnormal	psap^f28/f28	chemical treatment by environment: monomethyl fumarate	Fig. 7. from Zhang et al., 2023
brain socs1a expression increased amount, abnormal	psap^f28/f28	standard conditions	Fig. 6. from Zhang et al., 2023
brain cd68 expression increased amount, abnormal	psap^f28/f28	chemical treatment by environment: monomethyl fumarate	Fig. 7. from Zhang et al., 2023
brain stat2 expression increased amount, abnormal	psap^f28/f28	standard conditions	Fig. 6. from Zhang et al., 2023
brain sphingomyelin increased amount, abnormal	psap^f28/f28	standard conditions	Fig. 2. from Zhang et al., 2023
brain ceramide increased amount, abnormal	psap^f28/f28	standard conditions	Fig. 2. from Zhang et al., 2023
brain myelination decreased occurrence, abnormal	psap^f28/f28	standard conditions	Fig. 3. from Zhang et al., 2023
whole organism life span, ameliorated	smpd1^f30/f30; psap^f28/f28	standard conditions	Fig. 7. from Zhang et al., 2023

Citations