CRISPR

CRISPR1-brsk2b

ID
ZDB-CRISPR-221228-1
Name
CRISPR1-brsk2b
Previous Names
None
Target
Sequence
5' - GGGCAGGTTAACACCCAAAG - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
Genomic Feature Affected Genomic Regions
zf3706 brsk2b
Expression
Gene expression in Wild Types + CRISPR1-brsk2b
No data available
Phenotype
Phenotype resulting from CRISPR1-brsk2b
No data available
Phenotype of all Fish created by or utilizing CRISPR1-brsk2b
Phenotype Fish Conditions Figures
whole organism homer1b expression increased amount, abnormal brsk2bzf3706/zf3706 (TU) standard conditions Fig. 9 with image from Deng et al., 2022
thigmotaxis increased occurrence, abnormal brsk2bzf3706/zf3706 (TU) standard conditions Fig. 6 with image from Deng et al., 2022
whole organism dead, abnormal brsk2bzf3706/zf3706 (TU) standard conditions Table 3 from Deng et al., 2022
whole organism mbpa expression increased amount, abnormal brsk2bzf3706/zf3706 (TU) standard conditions Fig. 9 with image from Deng et al., 2022
pericardium edematous, abnormal brsk2bzf3706/zf3706 (TU) standard conditions Table 3 from Deng et al., 2022
whole organism mpz expression increased amount, abnormal brsk2bzf3706/zf3706 (TU) standard conditions Fig. 9 with image from Deng et al., 2022
multicellular organism development delayed, abnormal brsk2bzf3706/zf3706 (TU) standard conditions Table 3 from Deng et al., 2022
optic tectum decreased size, abnormal brsk2bzf3706/zf3706 (TU) standard conditions Fig. 3 with image from Deng et al., 2022
swimming decreased linear velocity, abnormal brsk2bzf3706/zf3706 (TU) standard conditions Fig. 4 with imageFig. 6 with image from Deng et al., 2022
social behavior decreased occurrence, abnormal brsk2bzf3706/zf3706 (TU) standard conditions Fig. 5 with image from Deng et al., 2022
whole organism decreased length, abnormal brsk2bzf3706/zf3706 (TU) standard conditions Fig. 3 with image from Deng et al., 2022
whole organism isl1a expression decreased amount, abnormal brsk2bzf3706/zf3706 (TU) standard conditions Fig. 9 with image from Deng et al., 2022
whole organism plp1b expression increased amount, abnormal brsk2bzf3706/zf3706 (TU) standard conditions Fig. 9 with image from Deng et al., 2022
whole organism decreased length, abnormal brsk2bzf3706/+ (TU) standard conditions Fig. 3 with image from Deng et al., 2022
swimming decreased linear velocity, abnormal brsk2bzf3706/+ (TU) standard conditions Fig. 4 with imageFig. 6 with image from Deng et al., 2022
optic tectum decreased size, abnormal brsk2bzf3706/+ (TU) standard conditions Fig. 3 with image from Deng et al., 2022
brain brsk2a expression decreased amount, abnormal brsk2azf3919/zf3919; brsk2bzf3706/zf3706 (TU) standard conditions Figure 2 with image from Deng et al., 2023
brain brsk2b expression decreased amount, abnormal brsk2azf3919/zf3919; brsk2bzf3706/zf3706 (TU) standard conditions Figure 2 with image from Deng et al., 2023
social behavior decreased process quality, abnormal brsk2azf3919/zf3919; brsk2bzf3706/zf3706 (TU) standard conditions Figure 5 with image from Deng et al., 2023
thigmotaxis increased process quality, abnormal brsk2azf3919/zf3919; brsk2bzf3706/zf3706 (TU) standard conditions Figure 6 with image from Deng et al., 2023
swimming behavior decreased process quality, abnormal brsk2azf3919/zf3919; brsk2bzf3706/zf3706 (TU) standard conditions Figure 4 with image from Deng et al., 2023
whole organism decreased length, abnormal brsk2azf3919/zf3919; brsk2bzf3706/zf3706 (TU) standard conditions Figure 3 with image from Deng et al., 2023
Citations