CRISPR

CRISPR4-b3galt6

ID

ZDB-CRISPR-210820-2

Name

CRISPR4-b3galt6

Previous Names

None

Target

b3galt6 (1)

Sequence

5' - GGGGTTCGTAATCGGCACCG - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

The first two "G"s were added.

Genome Resources

None

Target Location

Constructs

No data available

Genomic Features

Genomic Feature	Affected Genomic Regions
cmg20	b3galt6
cmg22	b3galt6

Expression

Gene expression in Wild Types + CRISPR4-b3galt6

No data available

Phenotype

Phenotype resulting from CRISPR4-b3galt6

No data available

Phenotype of all Fish created by or utilizing CRISPR4-b3galt6

Phenotype	Fish	Conditions	Figures
head cartilage development delayed, abnormal	b3galt6^cmg20/cmg20	standard conditions	FIGURE 3 from Delbaere et al., 2020
preural vertebra fused with preural vertebra, abnormal	b3galt6^cmg20/cmg20	standard conditions	FIGURE 5 from Delbaere et al., 2020
fin decreased size, abnormal	b3galt6^cmg20/cmg20	standard conditions	FIGURE 4 from Delbaere et al., 2020
muscle heparan sulfate decreased amount, abnormal	b3galt6^cmg20/cmg20	standard conditions	Table 1 from Delbaere et al., 2020
integument chondroitin sulfate decreased amount, abnormal	b3galt6^cmg20/cmg20	standard conditions	Table 1 from Delbaere et al., 2020
olfactory region decreased size, abnormal	b3galt6^cmg20/cmg20	standard conditions	FIGURE 5 from Delbaere et al., 2020
muscle dermatan sulfate decreased amount, abnormal	b3galt6^cmg20/cmg20	standard conditions	Table 1 from Delbaere et al., 2020
swimming decreased efficacy, abnormal	b3galt6^cmg20/cmg20	standard conditions	FIGURE 8 from Delbaere et al., 2020
integument collagen network decreased mass density, abnormal	b3galt6^cmg20/cmg20	standard conditions	FIGURE 7 from Delbaere et al., 2020
bone tissue chondroitin sulfate decreased amount, abnormal	b3galt6^cmg20/cmg20	standard conditions	Table 1 from Delbaere et al., 2020
centrum bone tissue mislocalised, abnormal	b3galt6^cmg20/cmg20	standard conditions	FIGURE 5 from Delbaere et al., 2020
whole organism decreased weight, abnormal	b3galt6^cmg20/cmg20	standard conditions	FIGURE 4 from Delbaere et al., 2020
pectoral fin radial fused with pectoral fin radial, abnormal	b3galt6^cmg20/cmg20	standard conditions	FIGURE 5 from Delbaere et al., 2020
head bone mineralization delayed, abnormal	b3galt6^cmg20/cmg20	standard conditions	FIGURE 3 from Delbaere et al., 2020
pectoral fin cartilage development delayed, abnormal	b3galt6^cmg20/cmg20	standard conditions	FIGURE 3 from Delbaere et al., 2020
pigment cell mislocalised, abnormal	b3galt6^cmg20/cmg20	standard conditions	FIGURE 4 from Delbaere et al., 2020
centrum decreased volume, abnormal	b3galt6^cmg20/cmg20	standard conditions	FIGURE 6 from Delbaere et al., 2020
muscle A band increased size, abnormal	b3galt6^cmg20/cmg20	standard conditions	FIGURE 8 from Delbaere et al., 2020
whole organism b3galt6 expression decreased amount, abnormal	b3galt6^cmg20/cmg20	standard conditions	FIGURE 1 from Delbaere et al., 2020
integument heparan sulfate decreased amount, abnormal	b3galt6^cmg20/cmg20	standard conditions	Table 1 from Delbaere et al., 2020
integument dermatan sulfate decreased amount, abnormal	b3galt6^cmg20/cmg20	standard conditions	Table 1 from Delbaere et al., 2020
pectoral fin dorsal orientation, abnormal	b3galt6^cmg20/cmg20	standard conditions	FIGURE 4 from Delbaere et al., 2020
pigmentation disrupted, abnormal	b3galt6^cmg20/cmg20	standard conditions	FIGURE 4 from Delbaere et al., 2020
integument epidermis increased thickness, abnormal	b3galt6^cmg20/cmg20	standard conditions	FIGURE 7 from Delbaere et al., 2020
centrum collagen-containing extracellular matrix disorganized, abnormal	b3galt6^cmg20/cmg20	standard conditions	FIGURE 7 from Delbaere et al., 2020
neurocranium deformed, abnormal	b3galt6^cmg20/cmg20	standard conditions	FIGURE 5 from Delbaere et al., 2020
head decreased length, abnormal	b3galt6^cmg20/cmg20	standard conditions	FIGURE 3 , FIGURE 4 from Delbaere et al., 2020
caudal fin cartilage development delayed, abnormal	b3galt6^cmg20/cmg20	standard conditions	FIGURE 3 from Delbaere et al., 2020
muscle sarcomere increased size, abnormal	b3galt6^cmg20/cmg20	standard conditions	FIGURE 8 from Delbaere et al., 2020
pectoral fin radial malformed, abnormal	b3galt6^cmg20/cmg20	standard conditions	FIGURE 5 from Delbaere et al., 2020
cranium morphology, abnormal	b3galt6^cmg20/cmg20	standard conditions	FIGURE 3 , FIGURE 4 , FIGURE 5 from Delbaere et al., 2020
pectoral girdle bone mineralization delayed, abnormal	b3galt6^cmg20/cmg20	standard conditions	FIGURE 3 from Delbaere et al., 2020
pectoral fin radial decreased size, abnormal	b3galt6^cmg20/cmg20	standard conditions	FIGURE 5 from Delbaere et al., 2020
scale anatomical margin mineralized, abnormal	b3galt6^cmg20/cmg20	standard conditions	FIGURE 5 from Delbaere et al., 2020
opercular flap posterior margin malformed, abnormal	b3galt6^cmg20/cmg20	standard conditions	FIGURE 3 , FIGURE 4 from Delbaere et al., 2020
muscle I band increased size, abnormal	b3galt6^cmg20/cmg20	standard conditions	FIGURE 8 from Delbaere et al., 2020
swimming decreased linear velocity, abnormal	b3galt6^cmg20/cmg20	standard conditions	FIGURE 8 from Delbaere et al., 2020
caudal fin bone mineralization delayed, abnormal	b3galt6^cmg20/cmg20	standard conditions	FIGURE 3 from Delbaere et al., 2020
fin distal margin structurally discontinuous, abnormal	b3galt6^cmg20/cmg20	standard conditions	FIGURE 4 from Delbaere et al., 2020
whole organism decreased length, abnormal	b3galt6^cmg20/cmg20	standard conditions	FIGURE 4 from Delbaere et al., 2020

Citations