Morpholino

MO1-slc20a1a

ID
ZDB-MRPHLNO-210319-1
Name
MO1-slc20a1a
Previous Names
  • ATG-blocking Morpholino (1)
Target
Sequence
5' - CTGGAGAAAAACACTTCTGGCCTAC - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-slc20a1a
Expressed Gene Anatomy Figures
evx1 Fig. S5 from Rieke et al., 2020
pax2a Fig. S5 from Rieke et al., 2020
Phenotype
Phenotype resulting from MO1-slc20a1a
Phenotype Fish Figures
brain hydrocephalic, abnormal AB/TL + MO1-slc20a1a Fig. S3 from Rieke et al., 2020
cloaca disorganized, abnormal AB/TL + MO1-slc20a1a Fig. S5 from Rieke et al., 2020
cloaca evx1 expression increased distribution, abnormal AB/TL + MO1-slc20a1a Fig. S5 from Rieke et al., 2020
cloaca increased width, abnormal AB/TL + MO1-slc20a1a Fig. S5 from Rieke et al., 2020
cloaca malformed, abnormal AB/TL + MO1-slc20a1a Fig. S9,  FIGURE 1 with image from Rieke et al., 2020
cloaca morphology, abnormal AB/TL + MO1-slc20a1a Fig. S5,  FIGURE 1 with image from Rieke et al., 2020
cloaca development disrupted, abnormal AB/TL + MO1-slc20a1a Fig. S5,  Fig. S9,  FIGURE 3 with image from Rieke et al., 2020
cloacal chamber malformed, abnormal li1Tg + MO1-slc20a1a FIGURE 2 with image from Rieke et al., 2020
excretion disrupted, abnormal AB/TL + MO1-slc20a1a Fig. S9,  FIGURE 3 with image from Rieke et al., 2020
eye decreased size, abnormal AB/TL + MO1-slc20a1a Fig. S3 from Rieke et al., 2020
intestine distal region dilated, abnormal AB/TL + MO1-slc20a1a FIGURE 3 with image from Rieke et al., 2020
proctodeum imperforate, abnormal AB/TL + MO1-slc20a1a FIGURE 3 with image from Rieke et al., 2020
proctodeum pax2a expression increased distribution, abnormal AB/TL + MO1-slc20a1a Fig. S5 from Rieke et al., 2020
proctodeum pax2a expression spatial pattern, abnormal AB/TL + MO1-slc20a1a Fig. S5 from Rieke et al., 2020
pronephric tubule dilated, abnormal li1Tg + MO1-slc20a1a Fig. S7,  FIGURE 2 with image from Rieke et al., 2020
pronephros cystic, abnormal li1Tg + MO1-slc20a1a Fig. S7,  FIGURE 2 with image from Rieke et al., 2020
renal system morphology, abnormal AB/TL + MO1-slc20a1a Fig. S4 from Rieke et al., 2020
renal system development disrupted, abnormal AB/TL + MO1-slc20a1a Fig. S4,  FIGURE 2 with image from Rieke et al., 2020
whole organism decreased life span, abnormal AB/TL + MO1-slc20a1a FIGURE 1 with image from Rieke et al., 2020
Phenotype of all Fish created by or utilizing MO1-slc20a1a
Phenotype Fish Conditions Figures
cloaca development disrupted, abnormal AB/TL + MO1-slc20a1a standard conditions Fig. S5,  Fig. S9,  FIGURE 3 with image from Rieke et al., 2020
renal system development disrupted, abnormal AB/TL + MO1-slc20a1a standard conditions Fig. S4 from Rieke et al., 2020
proctodeum pax2a expression increased distribution, abnormal AB/TL + MO1-slc20a1a standard conditions Fig. S5 from Rieke et al., 2020
cloaca morphology, abnormal AB/TL + MO1-slc20a1a standard conditions Fig. S5,  FIGURE 1 with image from Rieke et al., 2020
eye decreased size, abnormal AB/TL + MO1-slc20a1a standard conditions Fig. S3 from Rieke et al., 2020
proctodeum imperforate, abnormal AB/TL + MO1-slc20a1a standard conditions FIGURE 3 with image from Rieke et al., 2020
proctodeum pax2a expression spatial pattern, abnormal AB/TL + MO1-slc20a1a standard conditions Fig. S5 from Rieke et al., 2020
brain hydrocephalic, abnormal AB/TL + MO1-slc20a1a standard conditions Fig. S3 from Rieke et al., 2020
renal system morphology, abnormal AB/TL + MO1-slc20a1a standard conditions Fig. S4 from Rieke et al., 2020
excretion disrupted, abnormal AB/TL + MO1-slc20a1a standard conditions Fig. S9,  FIGURE 3 with image from Rieke et al., 2020
cloaca increased width, abnormal AB/TL + MO1-slc20a1a standard conditions Fig. S5 from Rieke et al., 2020
intestine distal region dilated, abnormal AB/TL + MO1-slc20a1a standard conditions FIGURE 3 with image from Rieke et al., 2020
cloaca evx1 expression increased distribution, abnormal AB/TL + MO1-slc20a1a standard conditions Fig. S5 from Rieke et al., 2020
cloaca disorganized, abnormal AB/TL + MO1-slc20a1a standard conditions Fig. S5 from Rieke et al., 2020
whole organism decreased life span, abnormal AB/TL + MO1-slc20a1a standard conditions FIGURE 1 with image from Rieke et al., 2020
cloaca malformed, abnormal AB/TL + MO1-slc20a1a standard conditions Fig. S9,  FIGURE 1 with image from Rieke et al., 2020
pronephric tubule dilated, abnormal li1Tg + MO1-slc20a1a standard conditions Fig. S7,  FIGURE 2 with image from Rieke et al., 2020
renal system development disrupted, abnormal li1Tg + MO1-slc20a1a standard conditions FIGURE 2 with image from Rieke et al., 2020
pronephros cystic, abnormal li1Tg + MO1-slc20a1a standard conditions Fig. S7,  FIGURE 2 with image from Rieke et al., 2020
cloacal chamber malformed, abnormal li1Tg + MO1-slc20a1a standard conditions FIGURE 2 with image from Rieke et al., 2020
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.