Morpholino

MO1-opa1

ID
ZDB-MRPHLNO-130417-1
Name
MO1-opa1
Previous Names
None
Target
Sequence
5' - GATGAGTTTAGGATCTCTTTGCAGT - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Translation-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-opa1
Expressed Gene Anatomy Figures
dnm1l Fig. 5 with image from Rahn et al., 2013
mfn1b Fig. 5 with image from Rahn et al., 2013
mfn2 Fig. 5 with image from Rahn et al., 2013
mt-nd1 Fig. 6 with image from Rahn et al., 2013
ndufb8 Fig. 6 with image from Rahn et al., 2013
opa1 Fig. 6 from Li et al., 2014
Fig. 5 with image from Rahn et al., 2013
polg Fig. 6 with image from Rahn et al., 2013
polg2 Fig. 6 with image from Rahn et al., 2013
ppargc1a Fig. 6 with image from Rahn et al., 2013
twnk Fig. 6 with image from Rahn et al., 2013
Phenotype
Phenotype resulting from MO1-opa1
Phenotype Fish Figures
blood circulation disrupted, abnormal AB + MO1-opa1 Fig. 2 with image from Rahn et al., 2013
cardiac muscle cell increased size, abnormal WT + MO1-opa1 Fig. 6 from Li et al., 2014
cellular respiration decreased process quality, abnormal AB + MO1-opa1 Fig. 7 with image from Rahn et al., 2013
eye decreased size, abnormal AB + MO1-opa1 Fig. 2 with image,  Fig. 3 with image from Rahn et al., 2013
eye edematous, abnormal AB + MO1-opa1 Fig. 2 with image from Rahn et al., 2013
fourth ventricle increased size, abnormal AB + MO1-opa1 Fig. 2 with image from Rahn et al., 2013
heart decreased size, abnormal AB + MO1-opa1 Fig. 2 with image from Rahn et al., 2013
heart contraction decreased rate, abnormal AB + MO1-opa1 Fig. 3 with image from Rahn et al., 2013
heart looping disrupted, abnormal AB + MO1-opa1 Fig. 2 with image from Rahn et al., 2013
midbrain hindbrain boundary inconspicuous, abnormal AB + MO1-opa1 Fig. 2 with image from Rahn et al., 2013
muscle contractile muscle fiber disorganized, abnormal AB + MO1-opa1 Fig. 4 with image from Rahn et al., 2013
muscle cell mitochondrion broken, abnormal AB + MO1-opa1 Fig. 4 with image from Rahn et al., 2013
nucleate erythrocyte accumulation heart, abnormal AB + MO1-opa1 Fig. 2 with image from Rahn et al., 2013
pectoral fin decreased size, abnormal AB + MO1-opa1 Fig. 2 with image from Rahn et al., 2013
pericardium edematous, abnormal AB + MO1-opa1 Fig. 2 with image from Rahn et al., 2013
startle response decreased process quality, abnormal AB + MO1-opa1 Fig. SMovie 2 from Rahn et al., 2013
swimming behavior disrupted, abnormal AB + MO1-opa1 Fig. SMovie 2 from Rahn et al., 2013
whole organism dead, abnormal AB + MO1-opa1 text only from Rahn et al., 2013
whole organism opa1 expression decreased amount, abnormal WT + MO1-opa1 Fig. 6 from Li et al., 2014
whole organism decreased length, abnormal AB + MO1-opa1 Fig. 2 with image from Rahn et al., 2013
yolk edematous, abnormal AB + MO1-opa1 Fig. 2 with image from Rahn et al., 2013
yolk increased size, abnormal AB + MO1-opa1 Fig. 2 with image from Rahn et al., 2013
Phenotype of all Fish created by or utilizing MO1-opa1
Phenotype Fish Conditions Figures
whole organism decreased length, abnormal AB + MO1-opa1 standard conditions Fig. 2 with image from Rahn et al., 2013
fourth ventricle increased size, abnormal AB + MO1-opa1 standard conditions Fig. 2 with image from Rahn et al., 2013
heart looping disrupted, abnormal AB + MO1-opa1 standard conditions Fig. 2 with image from Rahn et al., 2013
muscle contractile muscle fiber disorganized, abnormal AB + MO1-opa1 standard conditions Fig. 4 with image from Rahn et al., 2013
muscle cell mitochondrion broken, abnormal AB + MO1-opa1 standard conditions Fig. 4 with image from Rahn et al., 2013
whole organism dead, abnormal AB + MO1-opa1 standard conditions text only from Rahn et al., 2013
eye decreased size, abnormal AB + MO1-opa1 standard conditions Fig. 2 with image,  Fig. 3 with image from Rahn et al., 2013
midbrain hindbrain boundary inconspicuous, abnormal AB + MO1-opa1 standard conditions Fig. 2 with image from Rahn et al., 2013
nucleate erythrocyte accumulation heart, abnormal AB + MO1-opa1 standard conditions Fig. 2 with image from Rahn et al., 2013
heart decreased size, abnormal AB + MO1-opa1 standard conditions Fig. 2 with image from Rahn et al., 2013
pericardium edematous, abnormal AB + MO1-opa1 standard conditions Fig. 2 with image from Rahn et al., 2013
eye edematous, abnormal AB + MO1-opa1 standard conditions Fig. 2 with image from Rahn et al., 2013
yolk edematous, abnormal AB + MO1-opa1 standard conditions Fig. 2 with image from Rahn et al., 2013
cellular respiration decreased process quality, abnormal AB + MO1-opa1 standard conditions Fig. 7 with image from Rahn et al., 2013
heart contraction decreased rate, abnormal AB + MO1-opa1 standard conditions Fig. 3 with image from Rahn et al., 2013
startle response decreased process quality, abnormal AB + MO1-opa1 standard conditions Fig. SMovie 2 from Rahn et al., 2013
blood circulation disrupted, abnormal AB + MO1-opa1 standard conditions Fig. 2 with image from Rahn et al., 2013
pectoral fin decreased size, abnormal AB + MO1-opa1 standard conditions Fig. 2 with image from Rahn et al., 2013
yolk increased size, abnormal AB + MO1-opa1 standard conditions Fig. 2 with image from Rahn et al., 2013
swimming behavior disrupted, abnormal AB + MO1-opa1 standard conditions Fig. SMovie 2 from Rahn et al., 2013
whole organism opa1 expression decreased amount, abnormal WT + MO1-opa1 standard conditions Fig. 6 from Li et al., 2014
cardiac muscle cell increased size, abnormal WT + MO1-opa1 standard conditions Fig. 6 from Li et al., 2014
dermis mitochondrion morphology, abnormal mitfaw2/w2; zf154Tg + MO1-opa1 standard conditions Fig. 3 from Eijkenboom et al., 2019
whole organism anterior-posterior axis curved, abnormal mitfaw2/w2; zf154Tg + MO1-opa1 standard conditions Fig. 2 from Eijkenboom et al., 2019
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.