CRISPR

CRISPR1-nanos2

ID

ZDB-CRISPR-190715-3

Name

CRISPR1-nanos2

Previous Names

None

Target

nanos2 (1)

Sequence

5' - GGAGCCACAGACTAAAGGCA - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Constructs

No data available

Genomic Features

Genomic Feature	Affected Genomic Regions
zf3087	nanos2
zf3088	nanos2

Expression

Gene expression in Wild Types + CRISPR1-nanos2

No data available

Phenotype

Phenotype resulting from CRISPR1-nanos2

No data available

Phenotype of all Fish created by or utilizing CRISPR1-nanos2

Phenotype	Fish	Conditions	Figures
testis lacks all parts of type germ line cell, abnormal	nanos2^{zf3087/zf3087}	standard conditions	Fig. S1 from Cao et al., 2019
ovary lacks all parts of type oogonia, abnormal	nanos2^{zf3087/zf3087}	standard conditions	Fig. 1 from Cao et al., 2019
female organism female with DSD, abnormal	nanos2^{zf3087/zf3087}	standard conditions	Fig. S1 from Cao et al., 2019
ovary anatomical structure homeostasis disrupted, abnormal	nanos2^{zf3087/zf3087}	standard conditions	Fig. S1 from Cao et al., 2019
ovary lacks all parts of type oocyte stage I, abnormal	nanos2^{zf3087/zf3087}	standard conditions	Fig. 1 from Cao et al., 2019
germline stem cell nanos2 expression absent, abnormal	nanos2^{zf3087/zf3087}	standard conditions	Fig. 1 from Cao et al., 2019
female organism phenotypic sex, abnormal	nanos2^{zf3087/zf3087}	standard conditions	Fig. S1 from Cao et al., 2019
ovary animal organ regeneration absent process, abnormal	nanos2^{zf3087/zf3087}	surgical manipulation: ovary	Fig. 4 from Cao et al., 2019
germ-line stem cell population maintenance disrupted, abnormal	nanos2^{zf3087/zf3087}	standard conditions	Fig. 1 , Fig. S1 from Cao et al., 2019
sex determination disrupted, abnormal	nanos2^{zf3087/zf3087}	standard conditions	Fig. S1 from Cao et al., 2019
testis lacks all parts of type germ line cell, abnormal	nanos2^{zf3088/zf3088}	standard conditions	Fig. S1 from Cao et al., 2019
ovary lacks all parts of type oogonia, abnormal	nanos2^{zf3088/zf3088}	standard conditions	Fig. 1 from Cao et al., 2019
female organism female with DSD, abnormal	nanos2^{zf3088/zf3088}	standard conditions	Fig. S1 from Cao et al., 2019
ovary lacks all parts of type oocyte stage I, abnormal	nanos2^{zf3088/zf3088}	standard conditions	Fig. 1 from Cao et al., 2019
ovary anatomical structure homeostasis disrupted, abnormal	nanos2^{zf3088/zf3088}	standard conditions	Fig. S1 from Cao et al., 2019
germline stem cell nanos2 expression absent, abnormal	nanos2^{zf3088/zf3088}	standard conditions	Fig. 1 from Cao et al., 2019
female organism phenotypic sex, abnormal	nanos2^{zf3088/zf3088}	standard conditions	Fig. S1 from Cao et al., 2019
sex determination disrupted, abnormal	nanos2^{zf3088/zf3088}	standard conditions	Fig. S1 from Cao et al., 2019
germ-line stem cell population maintenance disrupted, abnormal	nanos2^{zf3088/zf3088}	standard conditions	Fig. 1 , Fig. S1 from Cao et al., 2019
ovary animal organ regeneration absent process, abnormal	nanos2^{zf3088/zf3088}	surgical manipulation: ovary	Fig. 4 from Cao et al., 2019
ovary animal organ regeneration process quality, ameliorated	nanos2^{zf3087/zf3087}; cq41Tg; zf3086Tg	surgical manipulation: ovary, heat shock	Fig. 4 from Cao et al., 2019
ovary animal organ regeneration process quality, ameliorated	nanos2^{zf3088/zf3088}; cq41Tg; zf3086Tg	surgical manipulation: ovary, heat shock	Fig. 4 from Cao et al., 2019

Citations