Morpholino

MO1-lama2

ID

ZDB-MRPHLNO-060119-5

Name

MO1-lama2

Previous Names

lama2 MO (1)
MO-Lama2-1 (1)
MO2-lama2

Target

lama2 (1)

Sequence

5' - GCCACTAAACTCCGCGTGTCCATGT - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO1-lama2

Expressed Gene	Anatomy	Figures
mbpa	posterior lateral line myelinating Schwann cell	Fig. 5 from Petersen et al., 2015

Phenotype

Phenotype resulting from MO1-lama2

Phenotype	Fish	Figures
muscle organ development disrupted, abnormal	WT + MO1-lama2	Fig. 3 from Hall et al., 2007
myotome dystrophic, abnormal	AB/TU + MO1-lama2	Fig. 2 from Charvet et al., 2013
myotome structure, abnormal	WT + MO1-lama2	Fig. 3 from Hall et al., 2007
posterior lateral line myelination of posterior lateral line nerve axons decreased occurrence, abnormal	WT + MO1-lama2	Fig. 5 from Petersen et al., 2015
posterior lateral line Schwann cell development decreased process quality, abnormal	WT + MO1-lama2	Fig. 5 from Petersen et al., 2015
skeletal muscle tissue development decreased process quality, abnormal	AB/TU + MO1-lama2	Fig. 2 from Charvet et al., 2013

Phenotype of all Fish created by or utilizing MO1-lama2

Phenotype	Fish	Conditions	Figures
myotome dystrophic, abnormal	AB/TU + MO1-lama2	standard conditions	Fig. 2 from Charvet et al., 2013
skeletal muscle tissue development decreased process quality, abnormal	AB/TU + MO1-lama2	standard conditions	Fig. 2 from Charvet et al., 2013
myotome structure, abnormal	WT + MO1-lama2	standard conditions	Fig. 3 from Hall et al., 2007
posterior lateral line myelination of posterior lateral line nerve axons decreased occurrence, abnormal	WT + MO1-lama2	standard conditions	Fig. 5 from Petersen et al., 2015
muscle organ development disrupted, abnormal	WT + MO1-lama2	standard conditions	Fig. 3 from Hall et al., 2007
posterior lateral line Schwann cell development decreased process quality, abnormal	WT + MO1-lama2	standard conditions	Fig. 5 from Petersen et al., 2015
posterior lateral line Schwann cell development decreased process quality, abnormal	adgrg6^st63/+ + MO1-lama2	standard conditions	Fig. 5 from Petersen et al., 2015
posterior lateral line myelination of posterior lateral line nerve axons arrested, abnormal	adgrg6^st63/st63 + MO1-lama2	standard conditions	Fig. 5 from Petersen et al., 2015
posterior lateral line Schwann cell development decreased process quality, abnormal	adgrg6^st63/st63 + MO1-lama2	standard conditions	Fig. 5 from Petersen et al., 2015
muscle attachment decreased process quality, abnormal	AB/TU + MO1-dag1 + MO1-lama2	standard conditions	Fig. 6 from Charvet et al., 2013
skeletal muscle cell detached from vertical myoseptum, abnormal	AB/TU + MO1-dag1 + MO1-lama2	standard conditions	Fig. 6 from Charvet et al., 2013
muscle attachment decreased process quality, abnormal	AB/TU + MO1-itga7 + MO1-lama2	standard conditions	Fig. 6 from Charvet et al., 2013
skeletal muscle cell detached from vertical myoseptum, abnormal	AB/TU + MO1-itga7 + MO1-lama2	standard conditions	Fig. 6 from Charvet et al., 2013

Citations