Morpholino

MO1-il1b

ID

ZDB-MRPHLNO-110620-2

Name

MO1-il1b

Previous Names

None

Target

il1b (1)

Sequence

5' - CCCACAAACTGCAAAATATCAGCTT - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

Splice-blocking MO.

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO1-il1b

No data available

Phenotype

Phenotype resulting from MO1-il1b

Phenotype	Fish	Figures
caudal hematopoietic tissue hematopoietic multipotent progenitor cell decreased amount, abnormal	la2Tg + MO1-il1b	Fig. 1 from Frame et al., 2020
macrophage chemotaxis decreased occurrence, abnormal	s1999tTg; sh256Tg + MO1-il1b	Fig. S2 from Ogryzko et al., 2014

Phenotype of all Fish created by or utilizing MO1-il1b

Phenotype	Fish	Conditions	Figures
whole organism decreased life span, exacerbated	AB + MO1-il1b	bacterial treatment by injection: Burkholderia cenocepacia	Fig. 8 from Mesureur et al., 2017
fin regeneration decreased efficacy, abnormal	WT + MO1-il1b	amputation: caudal fin	Fig. 7 from Hasegawa et al., 2017
regenerating fin decreased length, abnormal	WT + MO1-il1b	amputation: caudal fin	Fig. 7 from Hasegawa et al., 2017
caudal fin regenerating fin junba expression decreased amount, abnormal	WT + MO1-il1b	amputation: caudal fin	Fig. 7 from Hasegawa et al., 2017
regenerating fin cell population proliferation decreased occurrence, abnormal	WT + MO1-il1b	amputation: caudal fin	Fig. 7 from Hasegawa et al., 2017
notochord neutrophil decreased amount, abnormal	i114Tg + MO1-il1b	bacterial treatment by injection: Escherichia coli K-12	Fig. 7 from Nguyen-Chi et al., 2014
notochord neutrophil activation involved in immune response decreased occurrence, abnormal	i114Tg + MO1-il1b	bacterial treatment by injection: Escherichia coli K-12	Fig. 7 from Nguyen-Chi et al., 2014
caudal hematopoietic tissue hematopoietic multipotent progenitor cell decreased amount, abnormal	la2Tg + MO1-il1b	chemical treatment by environment: glucose	Fig. 1 from Frame et al., 2020
caudal hematopoietic tissue hematopoietic multipotent progenitor cell decreased amount, abnormal	la2Tg + MO1-il1b	standard conditions	Fig. 1 from Frame et al., 2020
macrophage chemotaxis decreased occurrence, abnormal	s1999tTg; sh256Tg + MO1-il1b	control	Fig. S2 from Ogryzko et al., 2014
defense response to bacterium decreased efficacy, abnormal	mitfa^w2/w2 + MO1-il1b	bacterial treatment by injection: Mycobacterium marinum M	Fig. 4 from Ogryzko et al., 2018
regenerating fin apoptotic process occurrence, ameliorated	WT + MO1-il1b + MO1-irf8	amputation: caudal fin	Fig. 5 from Hasegawa et al., 2017
regenerating fin apoptotic process occurrence, ameliorated	WT + MO1-il1b + MO1-spi1b	amputation: caudal fin	Fig. 5 from Hasegawa et al., 2017
regenerating fin apoptotic process occurrence, ameliorated	Df(Chr13:klhdc3,lclat1,npas4l,slc30a10)m39/m39 + MO1-il1b	amputation: caudal fin	Fig. 3 from Hasegawa et al., 2017
caudal fin regenerating fin EGFP expression decreased amount, abnormal	nkhgn21aEt + MO1-il1b	amputation: caudal fin	Fig. 7 from Hasegawa et al., 2017

Citations