Mapping Details

GENETIC MAPPING PANELS

Chr	Location	Mapped As	Panel	Mapped By	Scoring
7	60.7 cM	z7958	Boston MGH Cross (MGH)	Fishman, Mark C.	Data
7	246.58 cR	Z7958	Loeb/NIH/5000/4000 (LN54)	Dawid, Igor B.	Data
21	1562.0 cR	z7958	Goodfellow T51 (T51)	Geisler, Robert	Data
7	130.4 cM	z7958	Heat Shock (HS)	Woods, Ian G.	Data
Note: Physical map location as displayed in the genome browsers is more precise than linkage map location. Note: Physical map location should be used whenever possible.

MAPPING FROM PUBLICATIONS

Marker	Type	Chr	Distance	Publication / Person	Comments
z9869	SSLP	7		Kikuchi et al., 2001	Kikuchi, et al. (2001. Genes Dev 15:1493-1505.) report mapping the cas mutation to LG07 near Z7958 and Z9869.
s4	Feature	7		Kikuchi et al., 2001	Kikuchi, et al. (2001. Genes Dev 15:1493-1505.) report mapping the cas mutation to LG07 near Z7958 and Z9869.
sox32	GENE	7		Kikuchi et al., 2001	Kikuchi, et al. (2001. Genes Dev 15:1493-1505.) report mapping sox32 to LG07 near z7958 on the T51 mapping panel.
z8156	SSLP	7		McFarland et al., 2005	McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped LG 7 using  ... McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped LG 7 using a mitoic map constructed from 2916 haploid fish.
z8218	SSLP	7		McFarland et al., 2005	McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped LG 7 using  ... McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped LG 7 using a mitoic map constructed from 2916 haploid fish.
z26442	SSLP	7		McFarland et al., 2005	McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped LG 7 using  ... McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped LG 7 using a mitoic map constructed from 2916 haploid fish.
z14401	SSLP	7		McFarland et al., 2005	McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped LG 7 using  ... McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped LG 7 using a mitoic map constructed from 2916 haploid fish.
tx230	Feature	7	8.8 cM	McFarland et al., 2005	McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped the wegtx230 LG 7 using a mitoic map constructed from half-tetrad analysis of 114 fish.
z14644	SSLP	7		McFarland et al., 2005	McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped LG 7 using  ... McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped LG 7 using a mitoic map constructed from 2916 haploid fish.
z1798	SSLP	7		McFarland et al., 2005	McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped the  ... McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped the centromere of LG 7 using a mitoic map constructed from half-tetrad analysis of 125 fish. z7958 and z9869 correspond to the centromere.
z1239	SSLP	7		McFarland et al., 2005	McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped the  ... McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped the centromere of LG 7 using a mitoic map constructed from half-tetrad analysis of 125 fish. z7958 and z9869 correspond to the centromere.
z5467	SSLP	7		McFarland et al., 2005	McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped the  ... McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped the centromere of LG 7 using a mitoic map constructed from half-tetrad analysis of 125 fish. z7958 and z9869 correspond to the centromere.
fd21a02	EST	7		McFarland et al., 2005	McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped LG 7 using  ... McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped LG 7 using a mitoic map constructed from 2916 haploid fish.
fgf3	GENE	7		McFarland et al., 2005	McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped LG 7 using  ... McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped LG 7 using a mitoic map constructed from 2916 haploid fish.
z9869	SSLP	7	0.0 cM	McFarland et al., 2005	McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped the  ... McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped the centromere of LG 7 using a mitoic map constructed from half-tetrad analysis of 125 fish. z7958 and z9869 correspond to the centromere.
z8252	SSLP	7		McFarland et al., 2005	McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped LG 7 using  ... McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped LG 7 using a mitoic map constructed from 2916 haploid fish.
z13880	SSLP	7		McFarland et al., 2005	McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped the  ... McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped the centromere of LG 7 using a mitoic map constructed from half-tetrad analysis of 125 fish. z7958 and z9869 correspond to the centromere.
z8540	SSLP	7		McFarland et al., 2005	McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped LG 7 using  ... McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped LG 7 using a mitoic map constructed from 2916 haploid fish.
dtv43	Feature	7	4.5 cM	McFarland et al., 2005	McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped the habdtb43 LG 7 using a mitoic map constructed from half-tetrad analysis of 222 fish.
z6852	SSLP	7	1.4 cM	McFarland et al., 2005	McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped the  ... McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped the centromere of LG 7 using a mitoic map constructed from half-tetrad analysis of 125 fish. z7958 and z9869 correspond to the centromere.
z7244	SSLP	7		McFarland et al., 2005	McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped LG 7 using  ... McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped LG 7 using a mitoic map constructed from 2916 haploid fish.
z1059	SSLP	7		McFarland et al., 2005	McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped LG 7 using  ... McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped LG 7 using a mitoic map constructed from 2916 haploid fish.
z3008	SSLP	7		McFarland et al., 2005	McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped LG 7 using  ... McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped LG 7 using a mitoic map constructed from 2916 haploid fish.
z1239	SSLP	7		McFarland et al., 2005	McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped the habdtb43 LG 7 using a mitoic map constructed from half-tetrad analysis of 222 fish.
z8218	SSLP	7		McFarland et al., 2005	McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped the  ... McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped the centromere of LG 7 using a mitoic map constructed from half-tetrad analysis of 125 fish. z7958 and z9869 correspond to the centromere.
z14401	SSLP	7		McFarland et al., 2005	McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped the  ... McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped the centromere of LG 7 using a mitoic map constructed from half-tetrad analysis of 125 fish. z7958 and z9869 correspond to the centromere.
z6852	SSLP	7		McFarland et al., 2005	McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped LG 7 using  ... McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped LG 7 using a mitoic map constructed from 2916 haploid fish.
z1182	SSLP	7		McFarland et al., 2005	McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped LG 7 using  ... McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped LG 7 using a mitoic map constructed from 2916 haploid fish.
z1182	SSLP	7		McFarland et al., 2005	McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped the  ... McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped the centromere of LG 7 using a mitoic map constructed from half-tetrad analysis of 125 fish. z7958 and z9869 correspond to the centromere.
z1059	SSLP	7		McFarland et al., 2005	McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped the  ... McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped the centromere of LG 7 using a mitoic map constructed from half-tetrad analysis of 125 fish. z7958 and z9869 correspond to the centromere.
z8156	SSLP	7		McFarland et al., 2005	McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped the  ... McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped the centromere of LG 7 using a mitoic map constructed from half-tetrad analysis of 125 fish. z7958 and z9869 correspond to the centromere.
z20576	SSLP	7		McFarland et al., 2005	McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped LG 7 using  ... McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped LG 7 using a mitoic map constructed from 2916 haploid fish.
z11122	SSLP	7		McFarland et al., 2005	McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped the  ... McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped the centromere of LG 7 using a mitoic map constructed from half-tetrad analysis of 125 fish. z7958 and z9869 correspond to the centromere.
z6483	SSLP	7		McFarland et al., 2005	McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped the  ... McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped the centromere of LG 7 using a mitoic map constructed from half-tetrad analysis of 125 fish. z7958 and z9869 correspond to the centromere.
z13880	SSLP	7		McFarland et al., 2005	McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped LG 7 using  ... McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped LG 7 using a mitoic map constructed from 2916 haploid fish.
dtv43	Feature	7		McFarland et al., 2005	McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped LG 7 using  ... McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped LG 7 using a mitoic map constructed from 2916 haploid fish.
z1239	SSLP	7		McFarland et al., 2005	McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped LG 7 using  ... McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped LG 7 using a mitoic map constructed from 2916 haploid fish.
z3008	SSLP	7		McFarland et al., 2005	McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped the  ... McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped the centromere of LG 7 using a mitoic map constructed from half-tetrad analysis of 125 fish. z7958 and z9869 correspond to the centromere.
z8252	SSLP	7		McFarland et al., 2005	McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped the  ... McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped the centromere of LG 7 using a mitoic map constructed from half-tetrad analysis of 125 fish. z7958 and z9869 correspond to the centromere.
z9869	SSLP	7		McFarland et al., 2005	McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped LG 7 using  ... McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped LG 7 using a mitoic map constructed from 2916 haploid fish.
z1239	SSLP	7		McFarland et al., 2005	McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped the wegtx230 LG 7 using a mitoic map constructed from half-tetrad analysis of 114 fish.
fi19d09	EST	7		McFarland et al., 2005	McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped LG 7 using  ... McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped LG 7 using a mitoic map constructed from 2916 haploid fish.
z20715	SSLP	7		McFarland et al., 2005	McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped LG 7 using  ... McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped LG 7 using a mitoic map constructed from 2916 haploid fish.
z3445	SSLP	7		McFarland et al., 2005	McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped LG 7 using  ... McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped LG 7 using a mitoic map constructed from 2916 haploid fish.
z11625	SSLP	7		McFarland et al., 2005	McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped the  ... McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped the centromere of LG 7 using a mitoic map constructed from half-tetrad analysis of 125 fish. z7958 and z9869 correspond to the centromere.
fb64c10	EST	7		McFarland et al., 2005	McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped LG 7 using  ... McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped LG 7 using a mitoic map constructed from 2916 haploid fish.
z1239	SSLP	7		McFarland et al., 2005	McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped the lawts18 LG 7 using a mitoic map constructed from half-tetrad analysis of 163 fish.
fc89b01	EST	7		McFarland et al., 2005	McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped LG 7 using  ... McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped LG 7 using a mitoic map constructed from 2916 haploid fish.
fa11d03	EST	7		McFarland et al., 2005	McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped LG 7 using  ... McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped LG 7 using a mitoic map constructed from 2916 haploid fish.
z6852	SSLP	7		McFarland et al., 2005	McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped the habdtb43 LG 7 using a mitoic map constructed from half-tetrad analysis of 222 fish.
z11625	SSLP	7		McFarland et al., 2005	McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped LG 7 using  ... McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped LG 7 using a mitoic map constructed from 2916 haploid fish.
z8604	SSLP	7		McFarland et al., 2005	McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped LG 7 using  ... McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped LG 7 using a mitoic map constructed from 2916 haploid fish.
ts18	Feature	7	11.0 cM	McFarland et al., 2005	McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped the lawts18 LG 7 using a mitoic map constructed from half-tetrad analysis of 163 fish.
fb12g02	EST	7		McFarland et al., 2005	McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped LG 7 using  ... McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped LG 7 using a mitoic map constructed from 2916 haploid fish.
z20576	SSLP	7		McFarland et al., 2005	McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped the  ... McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped the centromere of LG 7 using a mitoic map constructed from half-tetrad analysis of 125 fish. z7958 and z9869 correspond to the centromere.
z8604	SSLP	7		McFarland et al., 2005	McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped the  ... McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped the centromere of LG 7 using a mitoic map constructed from half-tetrad analysis of 125 fish. z7958 and z9869 correspond to the centromere.
fb64f09	EST	7		McFarland et al., 2005	McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped LG 7 using  ... McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped LG 7 using a mitoic map constructed from 2916 haploid fish.
z1713	SSLP	7		McFarland et al., 2005	McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped the  ... McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped the centromere of LG 7 using a mitoic map constructed from half-tetrad analysis of 125 fish. z7958 and z9869 correspond to the centromere.
z8604	SSLP	7		Schonthaler et al., 2010	Schonthaler et al. (2010. Mech. Dev. 127:203-219) report mapping bum to LG7,  ... Schonthaler et al. (2010. Mech. Dev. 127:203-219) report mapping bum to LG7, between SSLP markers z8604 (0.2 cM) and z7958 (3.7 cM).
tg413	Feature	7	3.7 cM	Schonthaler et al., 2010	Schonthaler et al. (2010. Mech. Dev. 127:203-219) report mapping bum to LG7,  ... Schonthaler et al. (2010. Mech. Dev. 127:203-219) report mapping bum to LG7, between SSLP markers z8604 (0.2 cM) and z7958 (3.7 cM).
cct7	GENE	7		Walker et al., 2007	Walker et al., 2007, report the mapping of plcb3 to chromosome 7. Walker et al., 2007, report the mapping of plcb3 to chromosome 7.
plcb3	GENE	7		Walker et al., 2007	Walker et al., 2007, report the mapping of plcb3 to chromosome 7. Walker et al., 2007, report the mapping of plcb3 to chromosome 7.
z8540	SSLP	7		Walker et al., 2007	Walker et al., 2007, report the mapping of plcb3 to chromosome 7. Walker et al., 2007, report the mapping of plcb3 to chromosome 7.

OTHER MAPPING INFORMATION

Chr 7 Kikuchi et al., 2001 Kikuchi, et al. (2001. Genes Dev 15:1493-1505.) report mapping sox32 to LG07 near z7958 on  ... Kikuchi, et al. (2001. Genes Dev 15:1493-1505.) report mapping sox32 to LG07 near z7958 on the T51 mapping panel.   Chr 7 Kikuchi et al., 2001 Kikuchi, et al. (2001. Genes Dev 15:1493-1505.) report mapping the cas mutation to LG07 near  ... Kikuchi, et al. (2001. Genes Dev 15:1493-1505.) report mapping the cas mutation to LG07 near Z7958 and Z9869.   Chr 7 McFarland et al., 2005 McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped LG 7 using a mitoic map  ... McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped LG 7 using a mitoic map constructed from 2916 haploid fish.   Chr 7 Walker et al., 2007 Walker et al., 2007, report the mapping of plcb3 to chromosome 7. Walker et al., 2007, report the mapping of plcb3 to chromosome 7.

Primer Sets:

Strain	Bandsize	Restriction Enzyme	Annealing Temperature [C]
IND	198,162		60.0
Forward Primer	TGTCCCTCTGGAGAGATGCT
Reverse Primer	TCATTCCCAACTCAGAACCC
AB	208,168		60.0
Forward Primer	TGTCCCTCTGGAGAGATGCT
Reverse Primer	TCATTCCCAACTCAGAACCC
TU	208,196,160		60.0
Forward Primer	TGTCCCTCTGGAGAGATGCT
Reverse Primer	TCATTCCCAACTCAGAACCC
EKW	208,168		60.0
Forward Primer	TGTCCCTCTGGAGAGATGCT
Reverse Primer	TCATTCCCAACTCAGAACCC