Mapping Details

GENETIC MAPPING PANELS

Chr	Location	Mapped As	Panel	Mapped By	Scoring
23	34.0 cM	z4421	Boston MGH Cross (MGH)	Fishman, Mark C.	Data
23	108.8 cM	z4421	Mother of Pearl (MOP)	Postlethwait, John H.	Data
23	280.17 cR	Z4421	Loeb/NIH/5000/4000 (LN54)	Dawid, Igor B.	Data
23	4212.0 cR	z4421	Goodfellow T51 (T51)	Geisler, Robert	Data
23	89.4 cM	z4421	Heat Shock (HS)	Woods, Ian G.	Data
Note: Physical map location as displayed in the genome browsers is more precise than linkage map location. Note: Physical map location should be used whenever possible.

MAPPING FROM PUBLICATIONS

Marker	Type	Chr	Distance	Publication / Person	Comments
st48	Feature	23		Lyons et al., 2005	Lyons et al.(2005, Curr. Biol. 15(6):513-524) mapped erbb3b to LG23 using bulk segregant analysis.
st14	Feature	23		Lyons et al., 2005	Lyons et al.(2005, Curr. Biol. 15(6):513-524) mapped erbb3b to LG23 using bulk segregant analysis.
z6142	SSLP	23		Lyons et al., 2005	Lyons et al.(2005, Curr. Biol. 15(6):513-524) mapped erbb3b to LG23 using bulk segregant analysis.
z14967	SSLP	23		Roman et al., 2002	Roman, et al. (2002. Dev 129:3009-3019.) report mapping acvrl1 to a 1 cM meiotic interval between z14967 and z4421 on LG23. Finer mapping places the gene in a 0.035 cM interval between SNP b82sp6 and the tarama gene. That gap was spanned by two BACs (BAC177k23 and BAC157p19).
acvr1ba	GENE	23		Roman et al., 2002	Roman, et al. (2002. Dev 129:3009-3019.) report mapping acvrl1 to a 1 cM meiotic interval between z14967 and z4421 on LG23. Finer mapping places the gene in a 0.035 cM interval between SNP b82sp6 and the tarama gene. That gap was spanned by two BACs (BAC177k23 and BAC157p19).
acvrl1	GENE	23		Roman et al., 2002	Roman, et al. (2002. Dev 129:3009-3019.) report mapping acvrl1 to a 1 cM meiotic interval between z14967 and z4421 on LG23. Finer mapping places the gene in a 0.035 cM interval between SNP b82sp6 and the tarama gene. That gap was spanned by two BACs (BAC177k23 and BAC157p19).
neurod4	GENE	23		Wang et al., 2003	Using the T51 RH panel, Wang et al. (2003) Dev Dyn : 227:(4) mapped neurod4  ... Using the T51 RH panel, Wang et al. (2003) Dev Dyn : 227:(4) mapped neurod4 ("zath3") to a region ~34 cM from the top of LG 23.
j1607cTg	Feature	23		ZIRC and ZFIN staff

OTHER MAPPING INFORMATION

Chr 23 Roman et al., 2002 Roman, et al. (2002. Dev 129:3009-3019.) report mapping acvrl1 to a 1 cM meiotic interval  ... Roman, et al. (2002. Dev 129:3009-3019.) report mapping acvrl1 to a 1 cM meiotic interval between z14967 and z4421 on LG23. Finer mapping places the gene in a 0.035 cM interval between SNP b82sp6 and the tarama gene. That gap was spanned by two BACs (BAC177k23 and BAC157p19).   Chr 23 Wang et al., 2003 Using the T51 RH panel, Wang et al. (2003) Dev Dyn : 227:(4) mapped neurod4 ("zath3") to a region  ... Using the T51 RH panel, Wang et al. (2003) Dev Dyn : 227:(4) mapped neurod4 ("zath3") to a region ~34 cM from the top of LG 23.   Chr 23 Lyons et al., 2005 Lyons et al.(2005, Curr. Biol. 15(6):513-524) mapped erbb3b to LG23 using bulk segregant  ... Lyons et al.(2005, Curr. Biol. 15(6):513-524) mapped erbb3b to LG23 using bulk segregant analysis.   Chr 23 ZIRC and ZFIN staff

Primer Sets:

Strain	Bandsize	Restriction Enzyme	Annealing Temperature [C]
IND	NA
Forward Primer	TACTAATGGCCCAGGGCGAG
Reverse Primer	ACACCCTCCTTCACACCGGA
AB	NA
Forward Primer	TACTAATGGCCCAGGGCGAG
Reverse Primer	ACACCCTCCTTCACACCGGA